ID: 1160633383

View in Genome Browser
Species Human (GRCh38)
Location 18:80262845-80262867
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160633383_1160633390 13 Left 1160633383 18:80262845-80262867 CCTGCGCGGGCGCGCCGCCTTTG No data
Right 1160633390 18:80262881-80262903 GCGTTCTCCTTGTTAGGGTTAGG No data
1160633383_1160633388 7 Left 1160633383 18:80262845-80262867 CCTGCGCGGGCGCGCCGCCTTTG No data
Right 1160633388 18:80262875-80262897 GGAGTTGCGTTCTCCTTGTTAGG No data
1160633383_1160633396 26 Left 1160633383 18:80262845-80262867 CCTGCGCGGGCGCGCCGCCTTTG No data
Right 1160633396 18:80262894-80262916 TAGGGTTAGGGTTAGGGTTAGGG No data
1160633383_1160633395 25 Left 1160633383 18:80262845-80262867 CCTGCGCGGGCGCGCCGCCTTTG No data
Right 1160633395 18:80262893-80262915 TTAGGGTTAGGGTTAGGGTTAGG No data
1160633383_1160633392 19 Left 1160633383 18:80262845-80262867 CCTGCGCGGGCGCGCCGCCTTTG No data
Right 1160633392 18:80262887-80262909 TCCTTGTTAGGGTTAGGGTTAGG No data
1160633383_1160633389 8 Left 1160633383 18:80262845-80262867 CCTGCGCGGGCGCGCCGCCTTTG No data
Right 1160633389 18:80262876-80262898 GAGTTGCGTTCTCCTTGTTAGGG No data
1160633383_1160633391 14 Left 1160633383 18:80262845-80262867 CCTGCGCGGGCGCGCCGCCTTTG No data
Right 1160633391 18:80262882-80262904 CGTTCTCCTTGTTAGGGTTAGGG No data
1160633383_1160633394 20 Left 1160633383 18:80262845-80262867 CCTGCGCGGGCGCGCCGCCTTTG No data
Right 1160633394 18:80262888-80262910 CCTTGTTAGGGTTAGGGTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160633383 Original CRISPR CAAAGGCGGCGCGCCCGCGC AGG (reversed) Intergenic