ID: 1160635745

View in Genome Browser
Species Human (GRCh38)
Location 19:73728-73750
Sequence AAGGCTGCAGGGTTGGTCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160635737_1160635745 5 Left 1160635737 19:73700-73722 CCAGCTGGGCTGAGCGGGCCTGG No data
Right 1160635745 19:73728-73750 AAGGCTGCAGGGTTGGTCCCAGG No data
1160635732_1160635745 19 Left 1160635732 19:73686-73708 CCTGCCTTTGCTGGCCAGCTGGG No data
Right 1160635745 19:73728-73750 AAGGCTGCAGGGTTGGTCCCAGG No data
1160635734_1160635745 15 Left 1160635734 19:73690-73712 CCTTTGCTGGCCAGCTGGGCTGA No data
Right 1160635745 19:73728-73750 AAGGCTGCAGGGTTGGTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160635745 Original CRISPR AAGGCTGCAGGGTTGGTCCC AGG Intergenic
No off target data available for this crispr