ID: 1160636787

View in Genome Browser
Species Human (GRCh38)
Location 19:81163-81185
Sequence CTCCTTCATAAGCAAGCCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160636787_1160636791 30 Left 1160636787 19:81163-81185 CCTGTGGCTTGCTTATGAAGGAG No data
Right 1160636791 19:81216-81238 TATTGTATAAGATCACTGGCTGG No data
1160636787_1160636790 26 Left 1160636787 19:81163-81185 CCTGTGGCTTGCTTATGAAGGAG No data
Right 1160636790 19:81212-81234 ATCATATTGTATAAGATCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160636787 Original CRISPR CTCCTTCATAAGCAAGCCAC AGG (reversed) Intergenic
No off target data available for this crispr