ID: 1160640336

View in Genome Browser
Species Human (GRCh38)
Location 19:126034-126056
Sequence ATACAGAAAAGGAAAGCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160640333_1160640336 1 Left 1160640333 19:126010-126032 CCACTAAGTTAATATCTTTTGAA No data
Right 1160640336 19:126034-126056 ATACAGAAAAGGAAAGCAGAGGG No data
1160640332_1160640336 10 Left 1160640332 19:126001-126023 CCATGGTAACCACTAAGTTAATA No data
Right 1160640336 19:126034-126056 ATACAGAAAAGGAAAGCAGAGGG No data
1160640330_1160640336 12 Left 1160640330 19:125999-126021 CCCCATGGTAACCACTAAGTTAA No data
Right 1160640336 19:126034-126056 ATACAGAAAAGGAAAGCAGAGGG No data
1160640331_1160640336 11 Left 1160640331 19:126000-126022 CCCATGGTAACCACTAAGTTAAT No data
Right 1160640336 19:126034-126056 ATACAGAAAAGGAAAGCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160640336 Original CRISPR ATACAGAAAAGGAAAGCAGA GGG Intergenic
No off target data available for this crispr