ID: 1160641192

View in Genome Browser
Species Human (GRCh38)
Location 19:138565-138587
Sequence CTTTCCCCCATCGCAGCCTC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160641188_1160641192 20 Left 1160641188 19:138522-138544 CCATATTGTGGAAAACACCTCAG No data
Right 1160641192 19:138565-138587 CTTTCCCCCATCGCAGCCTCGGG No data
1160641187_1160641192 29 Left 1160641187 19:138513-138535 CCTTCACAGCCATATTGTGGAAA No data
Right 1160641192 19:138565-138587 CTTTCCCCCATCGCAGCCTCGGG No data
1160641190_1160641192 3 Left 1160641190 19:138539-138561 CCTCAGCAGTATGTGCTGGAATT No data
Right 1160641192 19:138565-138587 CTTTCCCCCATCGCAGCCTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160641192 Original CRISPR CTTTCCCCCATCGCAGCCTC GGG Intergenic
No off target data available for this crispr