ID: 1160654947

View in Genome Browser
Species Human (GRCh38)
Location 19:261129-261151
Sequence TCCACCCCGTGTAAATGAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160654947_1160654950 8 Left 1160654947 19:261129-261151 CCTCTTCATTTACACGGGGTGGA No data
Right 1160654950 19:261160-261182 AACCATTGAAATCCTTTAGAGGG No data
1160654947_1160654953 26 Left 1160654947 19:261129-261151 CCTCTTCATTTACACGGGGTGGA No data
Right 1160654953 19:261178-261200 GAGGGTATTTAAACCCCCAGAGG No data
1160654947_1160654949 7 Left 1160654947 19:261129-261151 CCTCTTCATTTACACGGGGTGGA No data
Right 1160654949 19:261159-261181 TAACCATTGAAATCCTTTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160654947 Original CRISPR TCCACCCCGTGTAAATGAAG AGG (reversed) Intergenic
No off target data available for this crispr