ID: 1160666096

View in Genome Browser
Species Human (GRCh38)
Location 19:329380-329402
Sequence CACCTTGGGCTACTATGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 77}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160666096_1160666103 21 Left 1160666096 19:329380-329402 CCTCTCCATAGTAGCCCAAGGTG 0: 1
1: 0
2: 0
3: 11
4: 77
Right 1160666103 19:329424-329446 TCAGCCGTGACTTCCATTTTTGG 0: 1
1: 0
2: 1
3: 5
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160666096 Original CRISPR CACCTTGGGCTACTATGGAG AGG (reversed) Intronic
905412308 1:37779080-37779102 CAGCTTGGGCTACAATGTGGAGG + Intergenic
910227711 1:84953301-84953323 CACCTTGGCCTCCTAAAGAGCGG - Intronic
917677382 1:177332771-177332793 CACCTTGGGGGTCTTTGGAGGGG + Intergenic
918848722 1:189654349-189654371 CAGCTTGGGTTGCTATGCAGAGG + Intergenic
924844014 1:247747186-247747208 TTCCTTGGACTACTATGGAAAGG - Intergenic
1070235226 10:74617838-74617860 CACCTTGGGCTCCCATAGTGCGG + Intronic
1074055694 10:109921724-109921746 CCCCTTGGGCTGAAATGGAGAGG - Intronic
1076717864 10:132375659-132375681 CACCTTTGGCTAGGAGGGAGGGG + Exonic
1079633699 11:22709809-22709831 CACCATGGAATACTATGCAGCGG + Intronic
1084899897 11:72301774-72301796 CACCTTGGGCCAGGATGGAGCGG - Intronic
1084944488 11:72631380-72631402 CACCTAGGGCTCCTAAGGAGTGG + Intronic
1096886555 12:54724660-54724682 CACCTTGGCTTACTATGAAGAGG + Intergenic
1100789546 12:98115493-98115515 CAGTTGGGGCTACTATGGAGGGG - Intergenic
1103313539 12:120032482-120032504 CACTGTGGGCTACAATGGTGAGG - Intronic
1113565702 13:111318484-111318506 CACCAAGGGCTTCTAGGGAGAGG - Intronic
1119170111 14:72528536-72528558 CACCTTGGGATGCAGTGGAGAGG - Intronic
1121182935 14:91943057-91943079 CACCTTGGGCTTGTATGGGGTGG + Intronic
1121328653 14:93036126-93036148 GACCTTGGGCTCCTGGGGAGGGG - Intronic
1122858111 14:104569730-104569752 CTCCTCGGGCTGCTATGGAGTGG + Intronic
1127376737 15:58392080-58392102 CACCATGGGCTACCATGCACTGG - Intronic
1129639750 15:77363384-77363406 TTCCTTAGGCAACTATGGAGAGG + Intronic
1139215971 16:65123879-65123901 CACCTTGGACACCTATGGTGGGG - Intronic
1142787766 17:2237674-2237696 GACCTAGGGCTCCTAAGGAGAGG + Intronic
1149650284 17:58272201-58272223 CACATCGGGCTGCTCTGGAGGGG - Intronic
1155214346 18:23629915-23629937 CACCTTGGGCAGCTAGGAAGAGG + Exonic
1156376092 18:36516477-36516499 CACCTTGGGCTACTATACACAGG - Intronic
1157567971 18:48692748-48692770 CACAATGGGCTCCTGTGGAGGGG + Intronic
1160666096 19:329380-329402 CACCTTGGGCTACTATGGAGAGG - Intronic
1162721242 19:12664307-12664329 CACCTTGGGCTAGCAGGGAGAGG + Intronic
1164810454 19:31150798-31150820 CCCCTTGGGCCACCATGGTGTGG + Intergenic
1165735489 19:38173147-38173169 CACTGTGGGCTACTCTGGAGAGG + Intronic
936629919 2:114191208-114191230 CAGCTTGGGCTCCTAAGGACAGG + Intergenic
937645250 2:124259200-124259222 CACCATGGAATACTATGCAGCGG - Intronic
939900115 2:147841467-147841489 CACCTTGGGCACTTAAGGAGAGG + Intergenic
941263122 2:163321858-163321880 CATCTTGTGCTACTCTCGAGTGG - Intergenic
944009673 2:194958766-194958788 CACCAAGGACCACTATGGAGAGG - Intergenic
946122874 2:217531763-217531785 CAGATTGGGCTGCTATGAAGAGG - Intronic
948260793 2:236603189-236603211 TACCTTGTGCTCCTATGAAGAGG - Intergenic
948337102 2:237218127-237218149 CACCTTGGTCTCCCATGCAGTGG + Intergenic
1173877118 20:46380348-46380370 CACCTGTGACTACTATCGAGAGG + Intronic
1174089499 20:48035786-48035808 CACCATGGGCAGTTATGGAGTGG + Intergenic
1175514471 20:59560093-59560115 CACCTTGGGGAACAATGGGGTGG - Intergenic
1183279337 22:36923745-36923767 CTCCTTGGTCTACTCTGGACAGG - Intronic
1183437335 22:37803634-37803656 CACAGTGGGCTACTGGGGAGGGG - Intergenic
1185329984 22:50248169-50248191 CACCTCGGGCTCCTGTGCAGTGG - Intronic
949872964 3:8605267-8605289 CCCCTTAGGCCATTATGGAGAGG - Intergenic
950252324 3:11476118-11476140 CACCTTAGGGTACAAAGGAGAGG - Intronic
953070494 3:39514936-39514958 CACCTTGTGCTCCTGTGGACTGG + Exonic
956975784 3:74576953-74576975 AACCTTGGCCTTCTAAGGAGAGG + Intergenic
962323094 3:134407218-134407240 CTCCCTGAGCTGCTATGGAGAGG + Intergenic
964181331 3:153890515-153890537 CTGCTTGGGATGCTATGGAGAGG + Intergenic
965798557 3:172467427-172467449 CACCTCTGGCCAGTATGGAGAGG + Intergenic
974451982 4:62075539-62075561 CACCTTGGTCTACAATGTACTGG - Intronic
978283090 4:107040221-107040243 TAGCTTGGTTTACTATGGAGAGG - Intronic
978516724 4:109576759-109576781 AACCTTGGACTACTATTGATGGG + Intronic
981233200 4:142383598-142383620 CATCATGGGATACTATTGAGAGG - Intronic
992595338 5:78341016-78341038 CCCCTTGGAATATTATGGAGAGG - Intergenic
997771302 5:136556767-136556789 CACCATGGGCTAGGATGTAGCGG + Intergenic
1001753666 5:174150195-174150217 CAGCTGGGGCTTCTGTGGAGGGG - Intronic
1002455476 5:179343884-179343906 CGCCCGGGGCCACTATGGAGTGG - Exonic
1002710214 5:181190730-181190752 AACCTTGAGCTACCCTGGAGTGG + Intergenic
1003170635 6:3719398-3719420 CACCTTAGGCTCCTGTGAAGTGG - Intergenic
1007662682 6:43496332-43496354 CACCCCGGGCTCCTCTGGAGGGG + Intronic
1012810486 6:103950441-103950463 CACCATGGAATACTATGCAGTGG - Intergenic
1013612525 6:111808323-111808345 CCCCCTGGGCTAGTATTGAGGGG + Intronic
1014617142 6:123617207-123617229 CACCTTGCCCTACTTTGGAATGG - Intronic
1014885036 6:126769540-126769562 CACTTTGGGGTAATATGGAGTGG + Intergenic
1019161383 6:170068879-170068901 CACCATGGGCCACTCTGCAGAGG - Intergenic
1022289555 7:28987921-28987943 CACCTTGGGCTTCAAAGGTGGGG + Intergenic
1022974859 7:35547699-35547721 CTCCTTGGGCACCTGTGGAGAGG + Intergenic
1028112940 7:86964835-86964857 CATCTAGGGCTAATATGAAGAGG + Intronic
1029194688 7:98797136-98797158 GTCCCTGGGCTACTTTGGAGTGG - Intergenic
1030133449 7:106222728-106222750 CACCTTGAGCTTCTAGGAAGTGG + Intergenic
1037582417 8:20253454-20253476 CTCCTTGGGCTTGTCTGGAGGGG + Exonic
1044345341 8:91098158-91098180 CACCTTGAACTTCTATGGACAGG + Intergenic
1048459400 8:134608554-134608576 CACCGAGGGCTGCCATGGAGGGG + Intronic
1049018361 8:139937458-139937480 CGCCTTGGGCTCCTAGGAAGGGG - Intronic
1049554053 8:143273539-143273561 CAGCTTGGCCCACCATGGAGGGG - Intronic
1051713799 9:19960498-19960520 AACCTTGGGCTGCTATTGTGTGG + Intergenic
1052265476 9:26566736-26566758 CACCTTGGTCTCCTCTGGACAGG + Intergenic
1055600843 9:77916786-77916808 CACCTTGGGCCAATGTTGAGTGG - Intronic
1058685100 9:107473279-107473301 CACCTTGGGTTGCTATGGATTGG - Intergenic
1187054118 X:15725303-15725325 CACTTTGGGATACCAAGGAGGGG + Intronic
1198177820 X:134172994-134173016 CACCTTGTGCTACTGTTGGGAGG + Intergenic
1198890569 X:141391093-141391115 CACCATGGAATACTATGCAGCGG - Intergenic
1200059070 X:153476058-153476080 CACCTTGGACTGCTAAGCAGAGG - Intronic
1200134113 X:153866652-153866674 CACTATCGGCTACTCTGGAGAGG - Exonic
1202296935 Y:23368514-23368536 CACCCTGGGCTACAGTGCAGTGG + Intergenic
1202573872 Y:26302083-26302105 CACCCTGGGCTACAGTGCAGTGG - Intergenic