ID: 1160668440

View in Genome Browser
Species Human (GRCh38)
Location 19:344519-344541
Sequence GTGCGCATGCGCGGCGGCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 18 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160668440_1160668455 14 Left 1160668440 19:344519-344541 CCCGCGCCGCCGCGCATGCGCAC No data
Right 1160668455 19:344556-344578 TGGCAGCCGGGGGAGTTGGGGGG 0: 1
1: 0
2: 0
3: 42
4: 507
1160668440_1160668456 17 Left 1160668440 19:344519-344541 CCCGCGCCGCCGCGCATGCGCAC No data
Right 1160668456 19:344559-344581 CAGCCGGGGGAGTTGGGGGGTGG 0: 1
1: 0
2: 4
3: 73
4: 967
1160668440_1160668448 4 Left 1160668440 19:344519-344541 CCCGCGCCGCCGCGCATGCGCAC No data
Right 1160668448 19:344546-344568 GCCCGCGATGTGGCAGCCGGGGG 0: 1
1: 0
2: 0
3: 7
4: 79
1160668440_1160668452 11 Left 1160668440 19:344519-344541 CCCGCGCCGCCGCGCATGCGCAC No data
Right 1160668452 19:344553-344575 ATGTGGCAGCCGGGGGAGTTGGG 0: 1
1: 0
2: 0
3: 11
4: 168
1160668440_1160668445 1 Left 1160668440 19:344519-344541 CCCGCGCCGCCGCGCATGCGCAC No data
Right 1160668445 19:344543-344565 GCAGCCCGCGATGTGGCAGCCGG 0: 1
1: 0
2: 1
3: 9
4: 113
1160668440_1160668454 13 Left 1160668440 19:344519-344541 CCCGCGCCGCCGCGCATGCGCAC No data
Right 1160668454 19:344555-344577 GTGGCAGCCGGGGGAGTTGGGGG 0: 1
1: 0
2: 3
3: 41
4: 415
1160668440_1160668447 3 Left 1160668440 19:344519-344541 CCCGCGCCGCCGCGCATGCGCAC No data
Right 1160668447 19:344545-344567 AGCCCGCGATGTGGCAGCCGGGG 0: 1
1: 0
2: 1
3: 5
4: 64
1160668440_1160668444 -6 Left 1160668440 19:344519-344541 CCCGCGCCGCCGCGCATGCGCAC No data
Right 1160668444 19:344536-344558 GCGCACTGCAGCCCGCGATGTGG 0: 1
1: 0
2: 0
3: 2
4: 61
1160668440_1160668457 18 Left 1160668440 19:344519-344541 CCCGCGCCGCCGCGCATGCGCAC No data
Right 1160668457 19:344560-344582 AGCCGGGGGAGTTGGGGGGTGGG 0: 1
1: 0
2: 2
3: 63
4: 613
1160668440_1160668460 20 Left 1160668440 19:344519-344541 CCCGCGCCGCCGCGCATGCGCAC No data
Right 1160668460 19:344562-344584 CCGGGGGAGTTGGGGGGTGGGGG 0: 1
1: 0
2: 13
3: 172
4: 1733
1160668440_1160668461 24 Left 1160668440 19:344519-344541 CCCGCGCCGCCGCGCATGCGCAC No data
Right 1160668461 19:344566-344588 GGGAGTTGGGGGGTGGGGGCCGG 0: 1
1: 5
2: 76
3: 735
4: 5157
1160668440_1160668463 29 Left 1160668440 19:344519-344541 CCCGCGCCGCCGCGCATGCGCAC No data
Right 1160668463 19:344571-344593 TTGGGGGGTGGGGGCCGGCCGGG 0: 1
1: 1
2: 4
3: 89
4: 1012
1160668440_1160668451 10 Left 1160668440 19:344519-344541 CCCGCGCCGCCGCGCATGCGCAC No data
Right 1160668451 19:344552-344574 GATGTGGCAGCCGGGGGAGTTGG 0: 1
1: 0
2: 0
3: 19
4: 328
1160668440_1160668464 30 Left 1160668440 19:344519-344541 CCCGCGCCGCCGCGCATGCGCAC No data
Right 1160668464 19:344572-344594 TGGGGGGTGGGGGCCGGCCGGGG 0: 1
1: 0
2: 12
3: 130
4: 1360
1160668440_1160668446 2 Left 1160668440 19:344519-344541 CCCGCGCCGCCGCGCATGCGCAC No data
Right 1160668446 19:344544-344566 CAGCCCGCGATGTGGCAGCCGGG 0: 1
1: 0
2: 0
3: 13
4: 108
1160668440_1160668458 19 Left 1160668440 19:344519-344541 CCCGCGCCGCCGCGCATGCGCAC No data
Right 1160668458 19:344561-344583 GCCGGGGGAGTTGGGGGGTGGGG 0: 1
1: 0
2: 8
3: 114
4: 1174
1160668440_1160668453 12 Left 1160668440 19:344519-344541 CCCGCGCCGCCGCGCATGCGCAC No data
Right 1160668453 19:344554-344576 TGTGGCAGCCGGGGGAGTTGGGG 0: 1
1: 0
2: 1
3: 28
4: 320
1160668440_1160668462 28 Left 1160668440 19:344519-344541 CCCGCGCCGCCGCGCATGCGCAC No data
Right 1160668462 19:344570-344592 GTTGGGGGGTGGGGGCCGGCCGG 0: 1
1: 0
2: 35
3: 597
4: 9146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160668440 Original CRISPR GTGCGCATGCGCGGCGGCGC GGG (reversed) Intronic
No off target data available for this crispr