ID: 1160668444

View in Genome Browser
Species Human (GRCh38)
Location 19:344536-344558
Sequence GCGCACTGCAGCCCGCGATG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 21 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160668428_1160668444 15 Left 1160668428 19:344498-344520 CCCACCCCGGCCCCCGCCCGCCC No data
Right 1160668444 19:344536-344558 GCGCACTGCAGCCCGCGATGTGG No data
1160668437_1160668444 -1 Left 1160668437 19:344514-344536 CCCGCCCCGCGCCGCCGCGCATG No data
Right 1160668444 19:344536-344558 GCGCACTGCAGCCCGCGATGTGG No data
1160668433_1160668444 5 Left 1160668433 19:344508-344530 CCCCCGCCCGCCCCGCGCCGCCG No data
Right 1160668444 19:344536-344558 GCGCACTGCAGCCCGCGATGTGG No data
1160668429_1160668444 14 Left 1160668429 19:344499-344521 CCACCCCGGCCCCCGCCCGCCCC No data
Right 1160668444 19:344536-344558 GCGCACTGCAGCCCGCGATGTGG No data
1160668436_1160668444 2 Left 1160668436 19:344511-344533 CCGCCCGCCCCGCGCCGCCGCGC No data
Right 1160668444 19:344536-344558 GCGCACTGCAGCCCGCGATGTGG No data
1160668423_1160668444 22 Left 1160668423 19:344491-344513 CCCCTCCCCCACCCCGGCCCCCG No data
Right 1160668444 19:344536-344558 GCGCACTGCAGCCCGCGATGTGG No data
1160668427_1160668444 16 Left 1160668427 19:344497-344519 CCCCACCCCGGCCCCCGCCCGCC No data
Right 1160668444 19:344536-344558 GCGCACTGCAGCCCGCGATGTGG No data
1160668422_1160668444 25 Left 1160668422 19:344488-344510 CCTCCCCTCCCCCACCCCGGCCC No data
Right 1160668444 19:344536-344558 GCGCACTGCAGCCCGCGATGTGG No data
1160668441_1160668444 -7 Left 1160668441 19:344520-344542 CCGCGCCGCCGCGCATGCGCACT No data
Right 1160668444 19:344536-344558 GCGCACTGCAGCCCGCGATGTGG No data
1160668435_1160668444 3 Left 1160668435 19:344510-344532 CCCGCCCGCCCCGCGCCGCCGCG 0: 1
1: 4
2: 41
3: 380
4: 1555
Right 1160668444 19:344536-344558 GCGCACTGCAGCCCGCGATGTGG No data
1160668424_1160668444 21 Left 1160668424 19:344492-344514 CCCTCCCCCACCCCGGCCCCCGC No data
Right 1160668444 19:344536-344558 GCGCACTGCAGCCCGCGATGTGG No data
1160668434_1160668444 4 Left 1160668434 19:344509-344531 CCCCGCCCGCCCCGCGCCGCCGC No data
Right 1160668444 19:344536-344558 GCGCACTGCAGCCCGCGATGTGG No data
1160668425_1160668444 20 Left 1160668425 19:344493-344515 CCTCCCCCACCCCGGCCCCCGCC No data
Right 1160668444 19:344536-344558 GCGCACTGCAGCCCGCGATGTGG No data
1160668439_1160668444 -5 Left 1160668439 19:344518-344540 CCCCGCGCCGCCGCGCATGCGCA No data
Right 1160668444 19:344536-344558 GCGCACTGCAGCCCGCGATGTGG No data
1160668440_1160668444 -6 Left 1160668440 19:344519-344541 CCCGCGCCGCCGCGCATGCGCAC No data
Right 1160668444 19:344536-344558 GCGCACTGCAGCCCGCGATGTGG No data
1160668430_1160668444 11 Left 1160668430 19:344502-344524 CCCCGGCCCCCGCCCGCCCCGCG No data
Right 1160668444 19:344536-344558 GCGCACTGCAGCCCGCGATGTGG No data
1160668438_1160668444 -2 Left 1160668438 19:344515-344537 CCGCCCCGCGCCGCCGCGCATGC No data
Right 1160668444 19:344536-344558 GCGCACTGCAGCCCGCGATGTGG No data
1160668432_1160668444 9 Left 1160668432 19:344504-344526 CCGGCCCCCGCCCGCCCCGCGCC No data
Right 1160668444 19:344536-344558 GCGCACTGCAGCCCGCGATGTGG No data
1160668431_1160668444 10 Left 1160668431 19:344503-344525 CCCGGCCCCCGCCCGCCCCGCGC No data
Right 1160668444 19:344536-344558 GCGCACTGCAGCCCGCGATGTGG No data
1160668426_1160668444 17 Left 1160668426 19:344496-344518 CCCCCACCCCGGCCCCCGCCCGC No data
Right 1160668444 19:344536-344558 GCGCACTGCAGCCCGCGATGTGG No data
1160668421_1160668444 26 Left 1160668421 19:344487-344509 CCCTCCCCTCCCCCACCCCGGCC No data
Right 1160668444 19:344536-344558 GCGCACTGCAGCCCGCGATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160668444 Original CRISPR GCGCACTGCAGCCCGCGATG TGG Intronic