ID: 1160668451

View in Genome Browser
Species Human (GRCh38)
Location 19:344552-344574
Sequence GATGTGGCAGCCGGGGGAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 348
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 328}

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160668437_1160668451 15 Left 1160668437 19:344514-344536 CCCGCCCCGCGCCGCCGCGCATG No data
Right 1160668451 19:344552-344574 GATGTGGCAGCCGGGGGAGTTGG 0: 1
1: 0
2: 0
3: 19
4: 328
1160668442_1160668451 4 Left 1160668442 19:344525-344547 CCGCCGCGCATGCGCACTGCAGC No data
Right 1160668451 19:344552-344574 GATGTGGCAGCCGGGGGAGTTGG 0: 1
1: 0
2: 0
3: 19
4: 328
1160668432_1160668451 25 Left 1160668432 19:344504-344526 CCGGCCCCCGCCCGCCCCGCGCC No data
Right 1160668451 19:344552-344574 GATGTGGCAGCCGGGGGAGTTGG 0: 1
1: 0
2: 0
3: 19
4: 328
1160668430_1160668451 27 Left 1160668430 19:344502-344524 CCCCGGCCCCCGCCCGCCCCGCG No data
Right 1160668451 19:344552-344574 GATGTGGCAGCCGGGGGAGTTGG 0: 1
1: 0
2: 0
3: 19
4: 328
1160668433_1160668451 21 Left 1160668433 19:344508-344530 CCCCCGCCCGCCCCGCGCCGCCG No data
Right 1160668451 19:344552-344574 GATGTGGCAGCCGGGGGAGTTGG 0: 1
1: 0
2: 0
3: 19
4: 328
1160668435_1160668451 19 Left 1160668435 19:344510-344532 CCCGCCCGCCCCGCGCCGCCGCG 0: 1
1: 4
2: 41
3: 380
4: 1555
Right 1160668451 19:344552-344574 GATGTGGCAGCCGGGGGAGTTGG 0: 1
1: 0
2: 0
3: 19
4: 328
1160668431_1160668451 26 Left 1160668431 19:344503-344525 CCCGGCCCCCGCCCGCCCCGCGC No data
Right 1160668451 19:344552-344574 GATGTGGCAGCCGGGGGAGTTGG 0: 1
1: 0
2: 0
3: 19
4: 328
1160668436_1160668451 18 Left 1160668436 19:344511-344533 CCGCCCGCCCCGCGCCGCCGCGC No data
Right 1160668451 19:344552-344574 GATGTGGCAGCCGGGGGAGTTGG 0: 1
1: 0
2: 0
3: 19
4: 328
1160668439_1160668451 11 Left 1160668439 19:344518-344540 CCCCGCGCCGCCGCGCATGCGCA No data
Right 1160668451 19:344552-344574 GATGTGGCAGCCGGGGGAGTTGG 0: 1
1: 0
2: 0
3: 19
4: 328
1160668441_1160668451 9 Left 1160668441 19:344520-344542 CCGCGCCGCCGCGCATGCGCACT No data
Right 1160668451 19:344552-344574 GATGTGGCAGCCGGGGGAGTTGG 0: 1
1: 0
2: 0
3: 19
4: 328
1160668440_1160668451 10 Left 1160668440 19:344519-344541 CCCGCGCCGCCGCGCATGCGCAC No data
Right 1160668451 19:344552-344574 GATGTGGCAGCCGGGGGAGTTGG 0: 1
1: 0
2: 0
3: 19
4: 328
1160668438_1160668451 14 Left 1160668438 19:344515-344537 CCGCCCCGCGCCGCCGCGCATGC No data
Right 1160668451 19:344552-344574 GATGTGGCAGCCGGGGGAGTTGG 0: 1
1: 0
2: 0
3: 19
4: 328
1160668443_1160668451 1 Left 1160668443 19:344528-344550 CCGCGCATGCGCACTGCAGCCCG No data
Right 1160668451 19:344552-344574 GATGTGGCAGCCGGGGGAGTTGG 0: 1
1: 0
2: 0
3: 19
4: 328
1160668429_1160668451 30 Left 1160668429 19:344499-344521 CCACCCCGGCCCCCGCCCGCCCC No data
Right 1160668451 19:344552-344574 GATGTGGCAGCCGGGGGAGTTGG 0: 1
1: 0
2: 0
3: 19
4: 328
1160668434_1160668451 20 Left 1160668434 19:344509-344531 CCCCGCCCGCCCCGCGCCGCCGC No data
Right 1160668451 19:344552-344574 GATGTGGCAGCCGGGGGAGTTGG 0: 1
1: 0
2: 0
3: 19
4: 328

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160668451 Original CRISPR GATGTGGCAGCCGGGGGAGT TGG Intronic