ID: 1160668457

View in Genome Browser
Species Human (GRCh38)
Location 19:344560-344582
Sequence AGCCGGGGGAGTTGGGGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 679
Summary {0: 1, 1: 0, 2: 2, 3: 63, 4: 613}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160668438_1160668457 22 Left 1160668438 19:344515-344537 CCGCCCCGCGCCGCCGCGCATGC No data
Right 1160668457 19:344560-344582 AGCCGGGGGAGTTGGGGGGTGGG 0: 1
1: 0
2: 2
3: 63
4: 613
1160668436_1160668457 26 Left 1160668436 19:344511-344533 CCGCCCGCCCCGCGCCGCCGCGC No data
Right 1160668457 19:344560-344582 AGCCGGGGGAGTTGGGGGGTGGG 0: 1
1: 0
2: 2
3: 63
4: 613
1160668433_1160668457 29 Left 1160668433 19:344508-344530 CCCCCGCCCGCCCCGCGCCGCCG No data
Right 1160668457 19:344560-344582 AGCCGGGGGAGTTGGGGGGTGGG 0: 1
1: 0
2: 2
3: 63
4: 613
1160668440_1160668457 18 Left 1160668440 19:344519-344541 CCCGCGCCGCCGCGCATGCGCAC No data
Right 1160668457 19:344560-344582 AGCCGGGGGAGTTGGGGGGTGGG 0: 1
1: 0
2: 2
3: 63
4: 613
1160668437_1160668457 23 Left 1160668437 19:344514-344536 CCCGCCCCGCGCCGCCGCGCATG No data
Right 1160668457 19:344560-344582 AGCCGGGGGAGTTGGGGGGTGGG 0: 1
1: 0
2: 2
3: 63
4: 613
1160668443_1160668457 9 Left 1160668443 19:344528-344550 CCGCGCATGCGCACTGCAGCCCG No data
Right 1160668457 19:344560-344582 AGCCGGGGGAGTTGGGGGGTGGG 0: 1
1: 0
2: 2
3: 63
4: 613
1160668441_1160668457 17 Left 1160668441 19:344520-344542 CCGCGCCGCCGCGCATGCGCACT No data
Right 1160668457 19:344560-344582 AGCCGGGGGAGTTGGGGGGTGGG 0: 1
1: 0
2: 2
3: 63
4: 613
1160668442_1160668457 12 Left 1160668442 19:344525-344547 CCGCCGCGCATGCGCACTGCAGC No data
Right 1160668457 19:344560-344582 AGCCGGGGGAGTTGGGGGGTGGG 0: 1
1: 0
2: 2
3: 63
4: 613
1160668435_1160668457 27 Left 1160668435 19:344510-344532 CCCGCCCGCCCCGCGCCGCCGCG 0: 1
1: 4
2: 41
3: 380
4: 1555
Right 1160668457 19:344560-344582 AGCCGGGGGAGTTGGGGGGTGGG 0: 1
1: 0
2: 2
3: 63
4: 613
1160668449_1160668457 -10 Left 1160668449 19:344547-344569 CCCGCGATGTGGCAGCCGGGGGA No data
Right 1160668457 19:344560-344582 AGCCGGGGGAGTTGGGGGGTGGG 0: 1
1: 0
2: 2
3: 63
4: 613
1160668439_1160668457 19 Left 1160668439 19:344518-344540 CCCCGCGCCGCCGCGCATGCGCA No data
Right 1160668457 19:344560-344582 AGCCGGGGGAGTTGGGGGGTGGG 0: 1
1: 0
2: 2
3: 63
4: 613
1160668434_1160668457 28 Left 1160668434 19:344509-344531 CCCCGCCCGCCCCGCGCCGCCGC No data
Right 1160668457 19:344560-344582 AGCCGGGGGAGTTGGGGGGTGGG 0: 1
1: 0
2: 2
3: 63
4: 613

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160668457 Original CRISPR AGCCGGGGGAGTTGGGGGGT GGG Intronic