ID: 1160668460

View in Genome Browser
Species Human (GRCh38)
Location 19:344562-344584
Sequence CCGGGGGAGTTGGGGGGTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1919
Summary {0: 1, 1: 0, 2: 13, 3: 172, 4: 1733}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160668438_1160668460 24 Left 1160668438 19:344515-344537 CCGCCCCGCGCCGCCGCGCATGC No data
Right 1160668460 19:344562-344584 CCGGGGGAGTTGGGGGGTGGGGG 0: 1
1: 0
2: 13
3: 172
4: 1733
1160668441_1160668460 19 Left 1160668441 19:344520-344542 CCGCGCCGCCGCGCATGCGCACT No data
Right 1160668460 19:344562-344584 CCGGGGGAGTTGGGGGGTGGGGG 0: 1
1: 0
2: 13
3: 172
4: 1733
1160668442_1160668460 14 Left 1160668442 19:344525-344547 CCGCCGCGCATGCGCACTGCAGC No data
Right 1160668460 19:344562-344584 CCGGGGGAGTTGGGGGGTGGGGG 0: 1
1: 0
2: 13
3: 172
4: 1733
1160668440_1160668460 20 Left 1160668440 19:344519-344541 CCCGCGCCGCCGCGCATGCGCAC No data
Right 1160668460 19:344562-344584 CCGGGGGAGTTGGGGGGTGGGGG 0: 1
1: 0
2: 13
3: 172
4: 1733
1160668435_1160668460 29 Left 1160668435 19:344510-344532 CCCGCCCGCCCCGCGCCGCCGCG 0: 1
1: 4
2: 41
3: 380
4: 1555
Right 1160668460 19:344562-344584 CCGGGGGAGTTGGGGGGTGGGGG 0: 1
1: 0
2: 13
3: 172
4: 1733
1160668439_1160668460 21 Left 1160668439 19:344518-344540 CCCCGCGCCGCCGCGCATGCGCA No data
Right 1160668460 19:344562-344584 CCGGGGGAGTTGGGGGGTGGGGG 0: 1
1: 0
2: 13
3: 172
4: 1733
1160668434_1160668460 30 Left 1160668434 19:344509-344531 CCCCGCCCGCCCCGCGCCGCCGC No data
Right 1160668460 19:344562-344584 CCGGGGGAGTTGGGGGGTGGGGG 0: 1
1: 0
2: 13
3: 172
4: 1733
1160668437_1160668460 25 Left 1160668437 19:344514-344536 CCCGCCCCGCGCCGCCGCGCATG No data
Right 1160668460 19:344562-344584 CCGGGGGAGTTGGGGGGTGGGGG 0: 1
1: 0
2: 13
3: 172
4: 1733
1160668450_1160668460 -9 Left 1160668450 19:344548-344570 CCGCGATGTGGCAGCCGGGGGAG No data
Right 1160668460 19:344562-344584 CCGGGGGAGTTGGGGGGTGGGGG 0: 1
1: 0
2: 13
3: 172
4: 1733
1160668449_1160668460 -8 Left 1160668449 19:344547-344569 CCCGCGATGTGGCAGCCGGGGGA No data
Right 1160668460 19:344562-344584 CCGGGGGAGTTGGGGGGTGGGGG 0: 1
1: 0
2: 13
3: 172
4: 1733
1160668443_1160668460 11 Left 1160668443 19:344528-344550 CCGCGCATGCGCACTGCAGCCCG No data
Right 1160668460 19:344562-344584 CCGGGGGAGTTGGGGGGTGGGGG 0: 1
1: 0
2: 13
3: 172
4: 1733
1160668436_1160668460 28 Left 1160668436 19:344511-344533 CCGCCCGCCCCGCGCCGCCGCGC No data
Right 1160668460 19:344562-344584 CCGGGGGAGTTGGGGGGTGGGGG 0: 1
1: 0
2: 13
3: 172
4: 1733

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160668460 Original CRISPR CCGGGGGAGTTGGGGGGTGG GGG Intronic