ID: 1160668461

View in Genome Browser
Species Human (GRCh38)
Location 19:344566-344588
Sequence GGGAGTTGGGGGGTGGGGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 5974
Summary {0: 1, 1: 5, 2: 76, 3: 735, 4: 5157}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160668443_1160668461 15 Left 1160668443 19:344528-344550 CCGCGCATGCGCACTGCAGCCCG No data
Right 1160668461 19:344566-344588 GGGAGTTGGGGGGTGGGGGCCGG 0: 1
1: 5
2: 76
3: 735
4: 5157
1160668440_1160668461 24 Left 1160668440 19:344519-344541 CCCGCGCCGCCGCGCATGCGCAC No data
Right 1160668461 19:344566-344588 GGGAGTTGGGGGGTGGGGGCCGG 0: 1
1: 5
2: 76
3: 735
4: 5157
1160668441_1160668461 23 Left 1160668441 19:344520-344542 CCGCGCCGCCGCGCATGCGCACT No data
Right 1160668461 19:344566-344588 GGGAGTTGGGGGGTGGGGGCCGG 0: 1
1: 5
2: 76
3: 735
4: 5157
1160668438_1160668461 28 Left 1160668438 19:344515-344537 CCGCCCCGCGCCGCCGCGCATGC No data
Right 1160668461 19:344566-344588 GGGAGTTGGGGGGTGGGGGCCGG 0: 1
1: 5
2: 76
3: 735
4: 5157
1160668450_1160668461 -5 Left 1160668450 19:344548-344570 CCGCGATGTGGCAGCCGGGGGAG No data
Right 1160668461 19:344566-344588 GGGAGTTGGGGGGTGGGGGCCGG 0: 1
1: 5
2: 76
3: 735
4: 5157
1160668449_1160668461 -4 Left 1160668449 19:344547-344569 CCCGCGATGTGGCAGCCGGGGGA No data
Right 1160668461 19:344566-344588 GGGAGTTGGGGGGTGGGGGCCGG 0: 1
1: 5
2: 76
3: 735
4: 5157
1160668437_1160668461 29 Left 1160668437 19:344514-344536 CCCGCCCCGCGCCGCCGCGCATG No data
Right 1160668461 19:344566-344588 GGGAGTTGGGGGGTGGGGGCCGG 0: 1
1: 5
2: 76
3: 735
4: 5157
1160668442_1160668461 18 Left 1160668442 19:344525-344547 CCGCCGCGCATGCGCACTGCAGC No data
Right 1160668461 19:344566-344588 GGGAGTTGGGGGGTGGGGGCCGG 0: 1
1: 5
2: 76
3: 735
4: 5157
1160668439_1160668461 25 Left 1160668439 19:344518-344540 CCCCGCGCCGCCGCGCATGCGCA No data
Right 1160668461 19:344566-344588 GGGAGTTGGGGGGTGGGGGCCGG 0: 1
1: 5
2: 76
3: 735
4: 5157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160668461 Original CRISPR GGGAGTTGGGGGGTGGGGGC CGG Intronic