ID: 1160668462

View in Genome Browser
Species Human (GRCh38)
Location 19:344570-344592
Sequence GTTGGGGGGTGGGGGCCGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 9779
Summary {0: 1, 1: 0, 2: 35, 3: 597, 4: 9146}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160668449_1160668462 0 Left 1160668449 19:344547-344569 CCCGCGATGTGGCAGCCGGGGGA No data
Right 1160668462 19:344570-344592 GTTGGGGGGTGGGGGCCGGCCGG 0: 1
1: 0
2: 35
3: 597
4: 9146
1160668450_1160668462 -1 Left 1160668450 19:344548-344570 CCGCGATGTGGCAGCCGGGGGAG No data
Right 1160668462 19:344570-344592 GTTGGGGGGTGGGGGCCGGCCGG 0: 1
1: 0
2: 35
3: 597
4: 9146
1160668443_1160668462 19 Left 1160668443 19:344528-344550 CCGCGCATGCGCACTGCAGCCCG No data
Right 1160668462 19:344570-344592 GTTGGGGGGTGGGGGCCGGCCGG 0: 1
1: 0
2: 35
3: 597
4: 9146
1160668440_1160668462 28 Left 1160668440 19:344519-344541 CCCGCGCCGCCGCGCATGCGCAC No data
Right 1160668462 19:344570-344592 GTTGGGGGGTGGGGGCCGGCCGG 0: 1
1: 0
2: 35
3: 597
4: 9146
1160668441_1160668462 27 Left 1160668441 19:344520-344542 CCGCGCCGCCGCGCATGCGCACT No data
Right 1160668462 19:344570-344592 GTTGGGGGGTGGGGGCCGGCCGG 0: 1
1: 0
2: 35
3: 597
4: 9146
1160668439_1160668462 29 Left 1160668439 19:344518-344540 CCCCGCGCCGCCGCGCATGCGCA No data
Right 1160668462 19:344570-344592 GTTGGGGGGTGGGGGCCGGCCGG 0: 1
1: 0
2: 35
3: 597
4: 9146
1160668442_1160668462 22 Left 1160668442 19:344525-344547 CCGCCGCGCATGCGCACTGCAGC No data
Right 1160668462 19:344570-344592 GTTGGGGGGTGGGGGCCGGCCGG 0: 1
1: 0
2: 35
3: 597
4: 9146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160668462 Original CRISPR GTTGGGGGGTGGGGGCCGGC CGG Intronic