ID: 1160668463

View in Genome Browser
Species Human (GRCh38)
Location 19:344571-344593
Sequence TTGGGGGGTGGGGGCCGGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1107
Summary {0: 1, 1: 1, 2: 4, 3: 89, 4: 1012}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160668439_1160668463 30 Left 1160668439 19:344518-344540 CCCCGCGCCGCCGCGCATGCGCA No data
Right 1160668463 19:344571-344593 TTGGGGGGTGGGGGCCGGCCGGG 0: 1
1: 1
2: 4
3: 89
4: 1012
1160668450_1160668463 0 Left 1160668450 19:344548-344570 CCGCGATGTGGCAGCCGGGGGAG No data
Right 1160668463 19:344571-344593 TTGGGGGGTGGGGGCCGGCCGGG 0: 1
1: 1
2: 4
3: 89
4: 1012
1160668449_1160668463 1 Left 1160668449 19:344547-344569 CCCGCGATGTGGCAGCCGGGGGA No data
Right 1160668463 19:344571-344593 TTGGGGGGTGGGGGCCGGCCGGG 0: 1
1: 1
2: 4
3: 89
4: 1012
1160668441_1160668463 28 Left 1160668441 19:344520-344542 CCGCGCCGCCGCGCATGCGCACT No data
Right 1160668463 19:344571-344593 TTGGGGGGTGGGGGCCGGCCGGG 0: 1
1: 1
2: 4
3: 89
4: 1012
1160668443_1160668463 20 Left 1160668443 19:344528-344550 CCGCGCATGCGCACTGCAGCCCG No data
Right 1160668463 19:344571-344593 TTGGGGGGTGGGGGCCGGCCGGG 0: 1
1: 1
2: 4
3: 89
4: 1012
1160668440_1160668463 29 Left 1160668440 19:344519-344541 CCCGCGCCGCCGCGCATGCGCAC No data
Right 1160668463 19:344571-344593 TTGGGGGGTGGGGGCCGGCCGGG 0: 1
1: 1
2: 4
3: 89
4: 1012
1160668442_1160668463 23 Left 1160668442 19:344525-344547 CCGCCGCGCATGCGCACTGCAGC No data
Right 1160668463 19:344571-344593 TTGGGGGGTGGGGGCCGGCCGGG 0: 1
1: 1
2: 4
3: 89
4: 1012

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160668463 Original CRISPR TTGGGGGGTGGGGGCCGGCC GGG Intronic