ID: 1160668464

View in Genome Browser
Species Human (GRCh38)
Location 19:344572-344594
Sequence TGGGGGGTGGGGGCCGGCCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1503
Summary {0: 1, 1: 0, 2: 12, 3: 130, 4: 1360}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160668450_1160668464 1 Left 1160668450 19:344548-344570 CCGCGATGTGGCAGCCGGGGGAG No data
Right 1160668464 19:344572-344594 TGGGGGGTGGGGGCCGGCCGGGG 0: 1
1: 0
2: 12
3: 130
4: 1360
1160668443_1160668464 21 Left 1160668443 19:344528-344550 CCGCGCATGCGCACTGCAGCCCG No data
Right 1160668464 19:344572-344594 TGGGGGGTGGGGGCCGGCCGGGG 0: 1
1: 0
2: 12
3: 130
4: 1360
1160668442_1160668464 24 Left 1160668442 19:344525-344547 CCGCCGCGCATGCGCACTGCAGC No data
Right 1160668464 19:344572-344594 TGGGGGGTGGGGGCCGGCCGGGG 0: 1
1: 0
2: 12
3: 130
4: 1360
1160668440_1160668464 30 Left 1160668440 19:344519-344541 CCCGCGCCGCCGCGCATGCGCAC No data
Right 1160668464 19:344572-344594 TGGGGGGTGGGGGCCGGCCGGGG 0: 1
1: 0
2: 12
3: 130
4: 1360
1160668441_1160668464 29 Left 1160668441 19:344520-344542 CCGCGCCGCCGCGCATGCGCACT No data
Right 1160668464 19:344572-344594 TGGGGGGTGGGGGCCGGCCGGGG 0: 1
1: 0
2: 12
3: 130
4: 1360
1160668449_1160668464 2 Left 1160668449 19:344547-344569 CCCGCGATGTGGCAGCCGGGGGA No data
Right 1160668464 19:344572-344594 TGGGGGGTGGGGGCCGGCCGGGG 0: 1
1: 0
2: 12
3: 130
4: 1360

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160668464 Original CRISPR TGGGGGGTGGGGGCCGGCCG GGG Intronic