ID: 1160669270

View in Genome Browser
Species Human (GRCh38)
Location 19:349284-349306
Sequence CCATTTTGGGAGCAGAGACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160669270_1160669277 4 Left 1160669270 19:349284-349306 CCTGGTCTCTGCTCCCAAAATGG No data
Right 1160669277 19:349311-349333 TTGGTACAGCATCCTCCAAAGGG No data
1160669270_1160669278 7 Left 1160669270 19:349284-349306 CCTGGTCTCTGCTCCCAAAATGG No data
Right 1160669278 19:349314-349336 GTACAGCATCCTCCAAAGGGAGG No data
1160669270_1160669281 27 Left 1160669270 19:349284-349306 CCTGGTCTCTGCTCCCAAAATGG No data
Right 1160669281 19:349334-349356 AGGAACACTGAACCCTCACATGG No data
1160669270_1160669276 3 Left 1160669270 19:349284-349306 CCTGGTCTCTGCTCCCAAAATGG No data
Right 1160669276 19:349310-349332 CTTGGTACAGCATCCTCCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160669270 Original CRISPR CCATTTTGGGAGCAGAGACC AGG (reversed) Intergenic
No off target data available for this crispr