ID: 1160669339

View in Genome Browser
Species Human (GRCh38)
Location 19:349687-349709
Sequence TTAAGGTCGGCAGGGCGCGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160669339_1160669345 -8 Left 1160669339 19:349687-349709 CCACCGCGCCCTGCCGACCTTAA No data
Right 1160669345 19:349702-349724 GACCTTAAGCCCTTTTGTAAGGG No data
1160669339_1160669349 11 Left 1160669339 19:349687-349709 CCACCGCGCCCTGCCGACCTTAA No data
Right 1160669349 19:349721-349743 AGGGTGCTAATCTACTCCTGAGG No data
1160669339_1160669350 12 Left 1160669339 19:349687-349709 CCACCGCGCCCTGCCGACCTTAA No data
Right 1160669350 19:349722-349744 GGGTGCTAATCTACTCCTGAGGG No data
1160669339_1160669344 -9 Left 1160669339 19:349687-349709 CCACCGCGCCCTGCCGACCTTAA No data
Right 1160669344 19:349701-349723 CGACCTTAAGCCCTTTTGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160669339 Original CRISPR TTAAGGTCGGCAGGGCGCGG TGG (reversed) Intergenic