ID: 1160669340

View in Genome Browser
Species Human (GRCh38)
Location 19:349690-349712
Sequence GGCTTAAGGTCGGCAGGGCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160669340_1160669349 8 Left 1160669340 19:349690-349712 CCGCGCCCTGCCGACCTTAAGCC No data
Right 1160669349 19:349721-349743 AGGGTGCTAATCTACTCCTGAGG No data
1160669340_1160669350 9 Left 1160669340 19:349690-349712 CCGCGCCCTGCCGACCTTAAGCC No data
Right 1160669350 19:349722-349744 GGGTGCTAATCTACTCCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160669340 Original CRISPR GGCTTAAGGTCGGCAGGGCG CGG (reversed) Intergenic