ID: 1160669341

View in Genome Browser
Species Human (GRCh38)
Location 19:349695-349717
Sequence AAAAGGGCTTAAGGTCGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160669341_1160669349 3 Left 1160669341 19:349695-349717 CCCTGCCGACCTTAAGCCCTTTT No data
Right 1160669349 19:349721-349743 AGGGTGCTAATCTACTCCTGAGG No data
1160669341_1160669350 4 Left 1160669341 19:349695-349717 CCCTGCCGACCTTAAGCCCTTTT No data
Right 1160669350 19:349722-349744 GGGTGCTAATCTACTCCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160669341 Original CRISPR AAAAGGGCTTAAGGTCGGCA GGG (reversed) Intergenic