ID: 1160669342

View in Genome Browser
Species Human (GRCh38)
Location 19:349696-349718
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160669342_1160669350 3 Left 1160669342 19:349696-349718 CCTGCCGACCTTAAGCCCTTTTG No data
Right 1160669350 19:349722-349744 GGGTGCTAATCTACTCCTGAGGG No data
1160669342_1160669349 2 Left 1160669342 19:349696-349718 CCTGCCGACCTTAAGCCCTTTTG No data
Right 1160669349 19:349721-349743 AGGGTGCTAATCTACTCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160669342 Original CRISPR CAAAAGGGCTTAAGGTCGGC AGG (reversed) Intergenic