ID: 1160669346

View in Genome Browser
Species Human (GRCh38)
Location 19:349704-349726
Sequence CACCCTTACAAAAGGGCTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160669346_1160669354 28 Left 1160669346 19:349704-349726 CCTTAAGCCCTTTTGTAAGGGTG No data
Right 1160669354 19:349755-349777 ATGTCTTAATCACCTGCCAAAGG No data
1160669346_1160669350 -5 Left 1160669346 19:349704-349726 CCTTAAGCCCTTTTGTAAGGGTG No data
Right 1160669350 19:349722-349744 GGGTGCTAATCTACTCCTGAGGG No data
1160669346_1160669349 -6 Left 1160669346 19:349704-349726 CCTTAAGCCCTTTTGTAAGGGTG No data
Right 1160669349 19:349721-349743 AGGGTGCTAATCTACTCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160669346 Original CRISPR CACCCTTACAAAAGGGCTTA AGG (reversed) Intergenic