ID: 1160669350

View in Genome Browser
Species Human (GRCh38)
Location 19:349722-349744
Sequence GGGTGCTAATCTACTCCTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160669346_1160669350 -5 Left 1160669346 19:349704-349726 CCTTAAGCCCTTTTGTAAGGGTG No data
Right 1160669350 19:349722-349744 GGGTGCTAATCTACTCCTGAGGG No data
1160669343_1160669350 -1 Left 1160669343 19:349700-349722 CCGACCTTAAGCCCTTTTGTAAG No data
Right 1160669350 19:349722-349744 GGGTGCTAATCTACTCCTGAGGG No data
1160669341_1160669350 4 Left 1160669341 19:349695-349717 CCCTGCCGACCTTAAGCCCTTTT No data
Right 1160669350 19:349722-349744 GGGTGCTAATCTACTCCTGAGGG No data
1160669340_1160669350 9 Left 1160669340 19:349690-349712 CCGCGCCCTGCCGACCTTAAGCC No data
Right 1160669350 19:349722-349744 GGGTGCTAATCTACTCCTGAGGG No data
1160669339_1160669350 12 Left 1160669339 19:349687-349709 CCACCGCGCCCTGCCGACCTTAA No data
Right 1160669350 19:349722-349744 GGGTGCTAATCTACTCCTGAGGG No data
1160669342_1160669350 3 Left 1160669342 19:349696-349718 CCTGCCGACCTTAAGCCCTTTTG No data
Right 1160669350 19:349722-349744 GGGTGCTAATCTACTCCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160669350 Original CRISPR GGGTGCTAATCTACTCCTGA GGG Intergenic
No off target data available for this crispr