ID: 1160670696

View in Genome Browser
Species Human (GRCh38)
Location 19:361442-361464
Sequence CCCTCAGGAGGAGCGTCGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160670689_1160670696 -7 Left 1160670689 19:361426-361448 CCGACGGTCCCGTGGGCCCTCAG No data
Right 1160670696 19:361442-361464 CCCTCAGGAGGAGCGTCGGCTGG No data
1160670688_1160670696 -1 Left 1160670688 19:361420-361442 CCTACTCCGACGGTCCCGTGGGC No data
Right 1160670696 19:361442-361464 CCCTCAGGAGGAGCGTCGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160670696 Original CRISPR CCCTCAGGAGGAGCGTCGGC TGG Intergenic