ID: 1160671327

View in Genome Browser
Species Human (GRCh38)
Location 19:365250-365272
Sequence AGAGCTCGCATCCACCCGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160671327_1160671337 10 Left 1160671327 19:365250-365272 CCTTCCGGGTGGATGCGAGCTCT No data
Right 1160671337 19:365283-365305 TGCCCTTGTGCAGGGTAAGGGGG No data
1160671327_1160671335 8 Left 1160671327 19:365250-365272 CCTTCCGGGTGGATGCGAGCTCT No data
Right 1160671335 19:365281-365303 GATGCCCTTGTGCAGGGTAAGGG No data
1160671327_1160671340 21 Left 1160671327 19:365250-365272 CCTTCCGGGTGGATGCGAGCTCT No data
Right 1160671340 19:365294-365316 AGGGTAAGGGGGCCAAGCAGTGG No data
1160671327_1160671341 22 Left 1160671327 19:365250-365272 CCTTCCGGGTGGATGCGAGCTCT No data
Right 1160671341 19:365295-365317 GGGTAAGGGGGCCAAGCAGTGGG No data
1160671327_1160671331 1 Left 1160671327 19:365250-365272 CCTTCCGGGTGGATGCGAGCTCT No data
Right 1160671331 19:365274-365296 CCCGGCAGATGCCCTTGTGCAGG No data
1160671327_1160671343 29 Left 1160671327 19:365250-365272 CCTTCCGGGTGGATGCGAGCTCT No data
Right 1160671343 19:365302-365324 GGGGCCAAGCAGTGGGGCCCTGG No data
1160671327_1160671333 2 Left 1160671327 19:365250-365272 CCTTCCGGGTGGATGCGAGCTCT No data
Right 1160671333 19:365275-365297 CCGGCAGATGCCCTTGTGCAGGG No data
1160671327_1160671336 9 Left 1160671327 19:365250-365272 CCTTCCGGGTGGATGCGAGCTCT No data
Right 1160671336 19:365282-365304 ATGCCCTTGTGCAGGGTAAGGGG No data
1160671327_1160671334 7 Left 1160671327 19:365250-365272 CCTTCCGGGTGGATGCGAGCTCT No data
Right 1160671334 19:365280-365302 AGATGCCCTTGTGCAGGGTAAGG No data
1160671327_1160671342 23 Left 1160671327 19:365250-365272 CCTTCCGGGTGGATGCGAGCTCT No data
Right 1160671342 19:365296-365318 GGTAAGGGGGCCAAGCAGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160671327 Original CRISPR AGAGCTCGCATCCACCCGGA AGG (reversed) Intronic