ID: 1160671337

View in Genome Browser
Species Human (GRCh38)
Location 19:365283-365305
Sequence TGCCCTTGTGCAGGGTAAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160671327_1160671337 10 Left 1160671327 19:365250-365272 CCTTCCGGGTGGATGCGAGCTCT No data
Right 1160671337 19:365283-365305 TGCCCTTGTGCAGGGTAAGGGGG No data
1160671328_1160671337 6 Left 1160671328 19:365254-365276 CCGGGTGGATGCGAGCTCTGCCC No data
Right 1160671337 19:365283-365305 TGCCCTTGTGCAGGGTAAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160671337 Original CRISPR TGCCCTTGTGCAGGGTAAGG GGG Intronic