ID: 1160677468

View in Genome Browser
Species Human (GRCh38)
Location 19:399093-399115
Sequence TTTTATACGCAGCAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 191}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160677468_1160677473 14 Left 1160677468 19:399093-399115 CCTTCCTCCTGCTGCGTATAAAA 0: 1
1: 0
2: 0
3: 6
4: 191
Right 1160677473 19:399130-399152 GCCGTTCCTTAGTAAACACTCGG 0: 1
1: 0
2: 0
3: 2
4: 58

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160677468 Original CRISPR TTTTATACGCAGCAGGAGGA AGG (reversed) Intergenic
900221363 1:1511117-1511139 TTTTAAAGGGAGCAGGAGTATGG + Intergenic
901210191 1:7520251-7520273 GTTTTTAGGCAGGAGGAGGAGGG - Intronic
903911517 1:26729849-26729871 TCTTATACACAGCAGGTAGATGG + Exonic
904320675 1:29696009-29696031 TATCATACCCAGGAGGAGGAGGG + Intergenic
906280420 1:44549640-44549662 GTTAAGAAGCAGCAGGAGGAAGG - Intronic
909316338 1:74223981-74224003 CTCTATAATCAGCAGGAGGAGGG - Intronic
909808670 1:79904703-79904725 TTTTATTAGCAGCACGAAGACGG - Intergenic
909984523 1:82144152-82144174 CTTTATAGGCAGCATGAGAATGG + Intergenic
912414412 1:109498339-109498361 ATTTATATTCTGCAGGAGGAAGG + Intronic
914668037 1:149848496-149848518 TTCAAGAGGCAGCAGGAGGATGG - Intronic
919373251 1:196758726-196758748 TTGTATACACAGCATTAGGATGG + Intergenic
920345183 1:205301725-205301747 GTCTTTACGCAGCAGGAGCAGGG + Intergenic
920924938 1:210331962-210331984 TTTTATACACAGAAGTGGGATGG - Intronic
924177755 1:241410084-241410106 TTTTATTCGTGCCAGGAGGAAGG + Intergenic
1062981205 10:1724520-1724542 TTGTGTGCGCAGCAGCAGGAGGG + Intronic
1064783352 10:18866936-18866958 TTTTATTAGCAGCATGAGAATGG + Intergenic
1065816385 10:29486910-29486932 TTTTTTACACAGGAGTAGGAAGG + Intronic
1065922493 10:30404875-30404897 CTTTATAAGCAGCATGAGAATGG + Intergenic
1065956480 10:30697743-30697765 TTTTTTACACAGGAGTAGGAAGG - Intergenic
1067843964 10:49703716-49703738 TGTTATATCCAGCGGGAGGAAGG - Intronic
1070591538 10:77805406-77805428 TGTTTCAGGCAGCAGGAGGAAGG - Intronic
1070764267 10:79047517-79047539 TTCTATAGGCAGCAGAAGGGAGG - Intergenic
1071719299 10:88127223-88127245 TTTTATGTGCAGCAGTAGCAAGG - Intergenic
1071827790 10:89342429-89342451 TTGTTTAAGGAGCAGGAGGATGG - Intronic
1072778648 10:98227339-98227361 TTTTATTGGGAGAAGGAGGAAGG - Intronic
1073530094 10:104222792-104222814 TTTTATATCCAGCAGGAAGCAGG + Intronic
1074784616 10:116827901-116827923 ATCTATATGCAGCAGGAGAAGGG - Intergenic
1074789575 10:116873280-116873302 TTCTATTAGCAGCAGCAGGAAGG + Intronic
1079570949 11:21942626-21942648 CTTTATAAGCAGCATGAGAATGG + Intergenic
1080846222 11:36029364-36029386 TGTTAAAGGGAGCAGGAGGAGGG + Intronic
1081299192 11:41429328-41429350 CTTTATTAGCAGCATGAGGACGG + Intronic
1083631045 11:64095709-64095731 TTCTAGATGCAGCAGGCGGAGGG + Intronic
1084684386 11:70685266-70685288 TTTTCTGGGCGGCAGGAGGAGGG - Intronic
1084694477 11:70745463-70745485 TTTTCAAGGCAGCAGGAGGAGGG - Intronic
1084736950 11:71111536-71111558 TGTTAGACGCAGCAGGCGGAAGG - Intronic
1085240093 11:75045935-75045957 TTTTATGGGCAGTAGGAAGAAGG - Intergenic
1086376102 11:86202429-86202451 TTTTATAAGCAGCAGTATGGTGG + Intergenic
1086586219 11:88455627-88455649 TTTTATTGGTAGCTGGAGGAAGG + Intergenic
1086920041 11:92575804-92575826 GTTAATAGGCAGAAGGAGGAAGG + Intronic
1087087125 11:94231189-94231211 TTTGCCACTCAGCAGGAGGAAGG - Intergenic
1091309189 11:134560841-134560863 TTTTTTAAGCAGGAGGAGGAGGG - Intergenic
1091888446 12:4033105-4033127 TTTCATCTGCAGCAGGATGAGGG + Intergenic
1095819287 12:46459824-46459846 TTTTCTATGCAGGAGGGGGATGG + Intergenic
1102397620 12:112600803-112600825 CTTTATTAGCAGCATGAGGACGG - Intronic
1108971761 13:56384711-56384733 TCTTATACACTGCTGGAGGAAGG - Intergenic
1112345372 13:98584862-98584884 ATTAGTACTCAGCAGGAGGAGGG + Intergenic
1113160136 13:107370688-107370710 TTTTGTTCGCAGCATGAGAACGG - Intronic
1113395717 13:109945649-109945671 TTTTATTAGCAGCATGAGAATGG + Intergenic
1113681341 13:112247247-112247269 GTTTCCACGCAGCAGGAGGCTGG + Intergenic
1114776087 14:25483192-25483214 TTGCATAACCAGCAGGAGGAAGG + Intergenic
1116862455 14:50005525-50005547 TTAAATAAGCAGCAGGAAGAAGG + Intronic
1118660771 14:68008219-68008241 ATTTATAATCAGCAAGAGGATGG + Intronic
1119764054 14:77177245-77177267 CTTTATCAGCAGCATGAGGACGG - Intronic
1122386281 14:101350476-101350498 TTTTCTGAGCAGCAGGAGGGTGG - Intergenic
1124204397 15:27704696-27704718 AATCATACACAGCAGGAGGATGG + Intergenic
1124809336 15:32918919-32918941 TTTTAGACACAGCAGGAAGGAGG + Intronic
1126181217 15:45787069-45787091 TTTAATAAGCAACAAGAGGAGGG - Intergenic
1126464063 15:48944450-48944472 TTTTCCAAGCAGCAGGAAGAAGG - Intronic
1128692656 15:69737015-69737037 TTGTATCCACAGAAGGAGGAAGG + Intergenic
1129078911 15:73022530-73022552 TTTTATAGGCAGTTGGAGGTGGG + Intergenic
1129166946 15:73784072-73784094 CTTTATTAGCAGCAGGAGAATGG + Intergenic
1131012296 15:89028341-89028363 TTCTATACGAGGCAGCAGGAAGG - Intergenic
1135515119 16:23125473-23125495 TTTTATATCCAGCTGGAGGAAGG - Intronic
1136926448 16:34379737-34379759 TTTGATAAGTAGAAGGAGGAGGG - Intergenic
1136978126 16:35032070-35032092 TTTGATAAGTAGAAGGAGGAGGG + Intergenic
1138000019 16:53268529-53268551 ATTTATATGCACAAGGAGGAGGG - Intronic
1138962558 16:62044977-62044999 TTTTATTAGCAGCATGAGAATGG + Intergenic
1139015122 16:62680497-62680519 CTTTATATGGAGCAGGAAGAGGG + Intergenic
1140071719 16:71656250-71656272 TTTTATACCCAGCAATAGAATGG - Intronic
1140379890 16:74477128-74477150 TTTAATAAGCAACAGGAAGAGGG + Intronic
1141214388 16:82010156-82010178 TTTTATTAGCAGCATGAGAATGG + Intronic
1142479181 17:207633-207655 GTTCAGATGCAGCAGGAGGACGG + Intergenic
1143989105 17:10941702-10941724 TTTTATGCTCAGAAAGAGGAGGG - Intergenic
1146606937 17:34268610-34268632 TTTTAGAAGCATCAGGTGGATGG + Intergenic
1147558664 17:41495890-41495912 TTTCAAACTCTGCAGGAGGATGG + Intergenic
1147770644 17:42865840-42865862 TTTTATTTGGAACAGGAGGACGG - Intergenic
1147998066 17:44372196-44372218 TTTATTAGGCAGCAGGAGGGGGG + Exonic
1149333108 17:55606808-55606830 ATTTTTAAGAAGCAGGAGGAAGG - Intergenic
1151132583 17:71912929-71912951 TTTTATTCACAGCTGGTGGATGG - Intergenic
1153326353 18:3824294-3824316 TTCTATTGGCAGCAAGAGGAAGG - Intronic
1153440307 18:5110453-5110475 TTATAAAAGAAGCAGGAGGATGG + Intergenic
1153509239 18:5834091-5834113 TTCTATACAAAGCAGGTGGAGGG + Intergenic
1153699139 18:7674920-7674942 TTTCAAACGCATCAGTAGGAAGG + Intronic
1154030403 18:10748539-10748561 TCTTCTTTGCAGCAGGAGGAAGG + Exonic
1155280119 18:24230592-24230614 TTTTTAATGCAGCAGAAGGAAGG + Intronic
1155413664 18:25572640-25572662 CTTTATTTGCAGCATGAGGATGG - Intergenic
1155521766 18:26675357-26675379 TTTTATTAGCAGCATGAGAACGG + Intergenic
1155821402 18:30382469-30382491 TTTTATACGTAATAGAAGGAAGG + Intergenic
1157983022 18:52404433-52404455 TTCACTATGCAGCAGGAGGAAGG - Intronic
1158073653 18:53503312-53503334 TTTTTAACTCAGCAGGTGGAAGG - Intronic
1158275830 18:55766363-55766385 TTTTATAAGCAGCGTGAGAACGG - Intergenic
1159779314 18:72642868-72642890 TTTTGTTTCCAGCAGGAGGAAGG - Intergenic
1160677468 19:399093-399115 TTTTATACGCAGCAGGAGGAAGG - Intergenic
1163627992 19:18401919-18401941 TTTTATAAGGAGCAGAGGGATGG + Intergenic
1164879308 19:31717658-31717680 TTTTATATAAAGCAGGAGAAGGG + Intergenic
1166326839 19:42056294-42056316 TTTTTTAAACAGGAGGAGGAAGG + Intronic
925684485 2:6457703-6457725 TTTTTTAGGCAGTATGAGGATGG - Intergenic
925862079 2:8188693-8188715 TTTTCTACAGACCAGGAGGAGGG + Intergenic
926415555 2:12646234-12646256 CTTTATAAGCAGCATGAGAATGG - Intergenic
927204186 2:20596758-20596780 CTTCAGACACAGCAGGAGGAAGG - Intronic
929626904 2:43418749-43418771 TTTGAGAGGCAGCGGGAGGAAGG + Intronic
930507627 2:52304473-52304495 TTTTATTAGCAGCATGAGAATGG + Intergenic
931594416 2:63926127-63926149 TTTCATCCGTAGCAGCAGGAAGG - Intronic
932098897 2:68878435-68878457 TTTGACACGCTGCAGGAAGAGGG + Intergenic
932305035 2:70695964-70695986 TTTTATTTGGAGCAGGAGAAAGG + Intronic
936949784 2:117966298-117966320 TTTTATACACTGATGGAGGAAGG + Intronic
938581506 2:132650697-132650719 TTTTAAAGGAAGGAGGAGGAAGG - Intronic
938873972 2:135513529-135513551 TTTCATATGCAGCATGAGGTGGG - Intronic
938918325 2:135967390-135967412 TTTTATACGTACCATGTGGAAGG - Intronic
939314358 2:140528696-140528718 TTTTGTAAGCAGTAGGAGCAAGG + Intronic
939684667 2:145184401-145184423 ATATATTGGCAGCAGGAGGAAGG + Intergenic
941453577 2:165689931-165689953 TTTTATTGGCAGTAGGATGAAGG + Intergenic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
943846682 2:192658049-192658071 TTTTAGAGGCAGCAGGAGTCTGG - Intergenic
945586051 2:211664430-211664452 CTTTATGGGCAGTAGGAGGATGG + Intronic
946027328 2:216679690-216679712 CTTCATAAGCGGCAGGAGGAGGG + Intronic
1172828995 20:37815945-37815967 TTTTATACGCAGCAGCCTGCAGG + Intronic
1173924435 20:46770342-46770364 CTTTATTAGCAGCATGAGGATGG - Intergenic
1174503005 20:50999404-50999426 TTTTATACAGAGCTGGAAGAAGG + Intergenic
1177107629 21:16979572-16979594 TTTTATAAGCAGAAGCAAGAGGG + Intergenic
1177201281 21:17959088-17959110 TTTTTTAGAAAGCAGGAGGAAGG + Intronic
1178556323 21:33593469-33593491 TTTTATTAACAGCAGTAGGAAGG - Intronic
1183310556 22:37107322-37107344 TTTCCTGCCCAGCAGGAGGAGGG + Intronic
949763723 3:7502055-7502077 ATTTATACGCAGCAGGCAGAAGG - Intronic
951177370 3:19617676-19617698 TTATATACCCAGCAGTGGGATGG + Intergenic
958726762 3:97915323-97915345 TTTTATAGGCAGCAAAAGTAAGG - Intronic
959211120 3:103382234-103382256 TTTTATCCCCAGAAGGTGGATGG - Intergenic
959429304 3:106232919-106232941 TAATGTATGCAGCAGGAGGAAGG + Intergenic
961219158 3:125186402-125186424 ATTTTTAGGCAGCAGGAGCAGGG - Intronic
962526273 3:136240590-136240612 TTTTCTAAGCAGCTGGAAGAGGG + Intergenic
965539235 3:169855695-169855717 TTTTATGCTCAGTAGTAGGAAGG - Intronic
966401804 3:179555220-179555242 TTTTTTAAGCAGGAGGTGGAGGG - Intergenic
971977158 4:33705085-33705107 TTTTATTAGCAGCAAGAGAATGG + Intergenic
972084144 4:35192574-35192596 TTTTATCAGCAGCATGAGAATGG - Intergenic
974093502 4:57336829-57336851 TTTTCAGAGCAGCAGGAGGATGG + Intergenic
977615136 4:99080190-99080212 TTTTCTTTGCAGCAGGAGGGAGG + Intronic
978687013 4:111457836-111457858 CTTTATTCGCAGCATGAGAATGG + Intergenic
979511362 4:121557414-121557436 TTTTATTAGCAGCATGAGAATGG + Intergenic
979594424 4:122518527-122518549 ATGTATACCCAGCAGTAGGATGG + Intergenic
979678515 4:123435235-123435257 TTTTATGCCTAGCTGGAGGATGG - Intergenic
979810298 4:125028422-125028444 TTTTATTAGCAGCAGGAAAATGG - Intergenic
979895986 4:126157519-126157541 TTTTATTAGCAGCATGAGAATGG - Intergenic
984002032 4:174259730-174259752 TTGTATATGCAGCTGGATGAAGG - Exonic
984279942 4:177658292-177658314 CTTTATTAGCAGCACGAGGATGG + Intergenic
985623479 5:969289-969311 TTTTCTTCGCGTCAGGAGGATGG - Intergenic
987137890 5:14916879-14916901 CTTTATCAGCAGCAGGAGAATGG + Intergenic
989699616 5:44247025-44247047 TTTTAAATGTAGCAGAAGGAAGG - Intergenic
989741256 5:44775267-44775289 GTGTATACTCAGCAGTAGGATGG + Intergenic
991233969 5:64372284-64372306 TTTTATACTCAGCAGAAGACAGG + Exonic
993336922 5:86671185-86671207 CTTTATAAGCAGCATGAGAATGG + Intergenic
994999580 5:107110352-107110374 TCTTAAAAGCTGCAGGAGGAGGG + Intergenic
996324393 5:122256278-122256300 TTTTATAGGCAGCAGATGGTTGG + Intergenic
1001376979 5:171269363-171269385 TTTTATACGCAGCAGAGAGCGGG - Intronic
1003386135 6:5669377-5669399 TTTTATAGGCAGCGGGGGGGTGG - Intronic
1003725958 6:8764313-8764335 TTTTAGAAGGACCAGGAGGAAGG - Intergenic
1004400075 6:15280410-15280432 TTTTTAATGCAGGAGGAGGAAGG - Intronic
1004973590 6:20939253-20939275 TAGTAAATGCAGCAGGAGGAAGG - Intronic
1007473830 6:42106618-42106640 TTGTAAACCCAGCAGGTGGATGG + Exonic
1008851735 6:56030435-56030457 CTTTATTAGCAGCATGAGGATGG + Intergenic
1010712913 6:79196100-79196122 CTTTATTAGCAGCAGGAGAATGG - Intergenic
1011565738 6:88669751-88669773 TTTTATGGGCAGCAGGAAAAAGG - Intronic
1017172435 6:151470568-151470590 TTTAATGCTTAGCAGGAGGAAGG + Intergenic
1017698492 6:157043270-157043292 TTTGAAATGCAGCAAGAGGAAGG - Intronic
1017868931 6:158469812-158469834 TTTAACAAGCAGCAGAAGGAAGG + Intronic
1020022415 7:4877123-4877145 TTGTCTACGCAGCAGGAGGCTGG - Intronic
1021341199 7:19464372-19464394 CTTTATTAGCAGCATGAGGACGG + Intergenic
1021849086 7:24790460-24790482 TTTTATGGGCAGTAGGAAGAAGG + Intergenic
1022151126 7:27607708-27607730 TTAGATAAGCAGCTGGAGGAAGG - Intronic
1022766428 7:33417450-33417472 TTTTATACCCAGTAGAAGGTTGG - Intronic
1024010043 7:45259446-45259468 TTTTCTAGGGAGCAGCAGGATGG - Intergenic
1030754514 7:113271819-113271841 TCTTGTAGGCAGCAGGTGGATGG - Intergenic
1032786220 7:135202215-135202237 TCCTATACTCAGCAGGAGGTAGG + Intronic
1036951258 8:13141731-13141753 TTTAATAGTCAGCAGGAGAATGG + Intronic
1037192318 8:16141600-16141622 TTATATACTCTGCATGAGGAGGG + Intronic
1037333196 8:17764871-17764893 TTTTCTGCGGACCAGGAGGAGGG + Intronic
1042212425 8:66393775-66393797 TTTTAGAGTCAGGAGGAGGAAGG - Intergenic
1045908079 8:107372407-107372429 TTTTAGAGGCACCAGGAGAATGG - Intronic
1045959793 8:107953651-107953673 TTTCCTAAGCAGCAGGATGATGG + Intronic
1048348729 8:133598519-133598541 TTTTACACTAAGCAGGAAGAAGG + Intergenic
1048618485 8:136105711-136105733 TACTATACGTACCAGGAGGAGGG + Intergenic
1049030668 8:140035042-140035064 CTGTATACACAGCTGGAGGAGGG + Intronic
1050751054 9:8937702-8937724 TTTTGTAAGAAGGAGGAGGAAGG - Intronic
1051894799 9:21975572-21975594 TTTTACACGCAGGAGGGGAAGGG - Intronic
1055725751 9:79226394-79226416 TTTTAAAAGGAGAAGGAGGAAGG - Intergenic
1057239740 9:93398389-93398411 CTTTATTCGCAGCGGGAGAATGG + Intergenic
1057789962 9:98118369-98118391 TTTTATAGGCCACAAGAGGAAGG - Intronic
1059263520 9:113003409-113003431 TTTTATTAGCAGCATGAGAATGG + Intergenic
1060308786 9:122440536-122440558 TTTTATTAGCAGCATGAGAATGG - Intergenic
1062316220 9:135968354-135968376 TTCTCTAGGCAGCAGGAGGGAGG + Intergenic
1186389913 X:9148548-9148570 ATTTATTTGCTGCAGGAGGATGG - Intronic
1188204700 X:27340680-27340702 TTTTATACACATCATGAGAAAGG + Intergenic
1189526065 X:41823279-41823301 TTCGATAGGCAGCAGGTGGAGGG - Intronic
1191908276 X:66119333-66119355 TTTGATATGCAGCAGGAGTTTGG + Intergenic
1192418124 X:71002753-71002775 CTTTATAAGCAGCATGAGAACGG + Intergenic
1194321717 X:92456704-92456726 TTATATGCGCAGGAAGAGGAGGG - Intronic
1197995349 X:132366877-132366899 CTTTATTAGCAGCATGAGGATGG - Intergenic
1199586145 X:149418357-149418379 TTTTATATACTGCTGGAGGAGGG + Intergenic
1202018061 Y:20433354-20433376 TTCTATACCCAGCAGGTTGAGGG - Intergenic