ID: 1160679838

View in Genome Browser
Species Human (GRCh38)
Location 19:407614-407636
Sequence CGCCCAGGACAGCCAGGCCA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 425
Summary {0: 1, 1: 0, 2: 3, 3: 43, 4: 378}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160679838_1160679847 17 Left 1160679838 19:407614-407636 CCTTGGCCTGGCTGTCCTGGGCG 0: 1
1: 0
2: 3
3: 43
4: 378
Right 1160679847 19:407654-407676 CACGGAGCGGGACAGCAGAGGGG 0: 1
1: 0
2: 1
3: 21
4: 196
1160679838_1160679844 5 Left 1160679838 19:407614-407636 CCTTGGCCTGGCTGTCCTGGGCG 0: 1
1: 0
2: 3
3: 43
4: 378
Right 1160679844 19:407642-407664 TTTGAGCAGAGACACGGAGCGGG 0: 1
1: 0
2: 0
3: 25
4: 231
1160679838_1160679851 29 Left 1160679838 19:407614-407636 CCTTGGCCTGGCTGTCCTGGGCG 0: 1
1: 0
2: 3
3: 43
4: 378
Right 1160679851 19:407666-407688 CAGCAGAGGGGACCCGAAGGGGG 0: 1
1: 0
2: 0
3: 21
4: 303
1160679838_1160679849 27 Left 1160679838 19:407614-407636 CCTTGGCCTGGCTGTCCTGGGCG 0: 1
1: 0
2: 3
3: 43
4: 378
Right 1160679849 19:407664-407686 GACAGCAGAGGGGACCCGAAGGG 0: 1
1: 0
2: 0
3: 13
4: 153
1160679838_1160679845 15 Left 1160679838 19:407614-407636 CCTTGGCCTGGCTGTCCTGGGCG 0: 1
1: 0
2: 3
3: 43
4: 378
Right 1160679845 19:407652-407674 GACACGGAGCGGGACAGCAGAGG 0: 1
1: 0
2: 0
3: 12
4: 143
1160679838_1160679841 -1 Left 1160679838 19:407614-407636 CCTTGGCCTGGCTGTCCTGGGCG 0: 1
1: 0
2: 3
3: 43
4: 378
Right 1160679841 19:407636-407658 GAAACCTTTGAGCAGAGACACGG 0: 1
1: 0
2: 3
3: 30
4: 317
1160679838_1160679846 16 Left 1160679838 19:407614-407636 CCTTGGCCTGGCTGTCCTGGGCG 0: 1
1: 0
2: 3
3: 43
4: 378
Right 1160679846 19:407653-407675 ACACGGAGCGGGACAGCAGAGGG 0: 1
1: 0
2: 0
3: 5
4: 117
1160679838_1160679848 26 Left 1160679838 19:407614-407636 CCTTGGCCTGGCTGTCCTGGGCG 0: 1
1: 0
2: 3
3: 43
4: 378
Right 1160679848 19:407663-407685 GGACAGCAGAGGGGACCCGAAGG 0: 1
1: 0
2: 2
3: 19
4: 246
1160679838_1160679843 4 Left 1160679838 19:407614-407636 CCTTGGCCTGGCTGTCCTGGGCG 0: 1
1: 0
2: 3
3: 43
4: 378
Right 1160679843 19:407641-407663 CTTTGAGCAGAGACACGGAGCGG 0: 1
1: 0
2: 1
3: 20
4: 175
1160679838_1160679850 28 Left 1160679838 19:407614-407636 CCTTGGCCTGGCTGTCCTGGGCG 0: 1
1: 0
2: 3
3: 43
4: 378
Right 1160679850 19:407665-407687 ACAGCAGAGGGGACCCGAAGGGG 0: 1
1: 0
2: 2
3: 22
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160679838 Original CRISPR CGCCCAGGACAGCCAGGCCA AGG (reversed) Exonic
900111049 1:1005802-1005824 CCCCCAGGACAGCTGGGCCTGGG + Intergenic
900484343 1:2914375-2914397 TGCCCAGGAAAGCCCTGCCAGGG - Intergenic
900622303 1:3593014-3593036 CGGCCAGCAGGGCCAGGCCAGGG + Intronic
900636510 1:3668837-3668859 AGCTCAGGGCAGCCAGGACAGGG - Intronic
900790289 1:4675467-4675489 CGCTCGGGACACCAAGGCCAGGG - Intronic
900992206 1:6103278-6103300 CACCCAGGAAAGCCTGGCCAGGG - Exonic
901056308 1:6450129-6450151 CACCCAGCACAGCCAGGGCTGGG + Intronic
901180130 1:7336116-7336138 CACCCAGTCCAGGCAGGCCATGG - Intronic
901226555 1:7616477-7616499 AGCCCAGGACTGCAAGGCGAAGG + Intronic
901436490 1:9250150-9250172 TGCCCAGCACAGCAAGGCCTAGG + Intronic
901514094 1:9733639-9733661 CACCCAGGTTAGCTAGGCCAAGG + Intronic
901873339 1:12151513-12151535 CTTCCAGGACACCCAGGCCCAGG + Intergenic
902386157 1:16077069-16077091 CCCCCAGGGCTGCCAGGGCAGGG - Intergenic
902386991 1:16081770-16081792 CCACCAGGTCAGCCAGGGCAGGG + Intergenic
902406795 1:16188724-16188746 CTCCCAGGACAGACTGGCCAAGG - Intergenic
902478041 1:16698361-16698383 CACCCAGCACAGCCAGGGCTGGG - Intergenic
902576007 1:17378044-17378066 AGCCCAAGGCAGCAAGGCCAAGG - Intronic
903140492 1:21335993-21336015 AGCCCAGAACTGCCAGGCCCTGG + Intronic
903692556 1:25184534-25184556 AGCCTAGGGCAGCCAGTCCATGG - Intergenic
903737766 1:25541213-25541235 CACCCAGGGCAGACTGGCCAAGG - Intergenic
904494555 1:30879266-30879288 TGCCCAGCCCAGCCAGGGCAGGG + Intronic
904895534 1:33814720-33814742 CTCCCAGGATAGCAAGGCCCTGG - Intronic
906680533 1:47723048-47723070 CCCCTAGTACAGCCAGGCCCGGG - Intergenic
907983639 1:59509042-59509064 CTCCCAGGACAGCCAGTACCTGG - Intronic
912557684 1:110528172-110528194 TCCCCAGGGCAGCCAGGCCTGGG - Intergenic
912940215 1:114038186-114038208 CCCCCAGGACAGGCAGGCATGGG + Intergenic
913053041 1:115133642-115133664 CGCCCAGGCCAGGCAGGTCCTGG - Intergenic
914854831 1:151343303-151343325 AGCCCAGGACAGCAAAGTCAGGG + Intronic
914971031 1:152308169-152308191 GGCCCAGGACAAGCAGGCCCCGG - Exonic
915245241 1:154551731-154551753 CGCCCAGGCCGGCCTGGCCAAGG + Intronic
917219197 1:172709545-172709567 CACACAGGCCAGACAGGCCATGG - Intergenic
917982723 1:180281640-180281662 CTCCCTGCACAGCCAGGCAAAGG - Intronic
920370677 1:205477527-205477549 CTCCCAGGAGACCCGGGCCAAGG - Intergenic
922788243 1:228294333-228294355 CATCCACCACAGCCAGGCCACGG - Exonic
923160208 1:231308509-231308531 AGCCCAGGAAAGTAAGGCCAGGG - Intergenic
924581322 1:245326492-245326514 ACCCCAGGACCGCCAGGCAAAGG + Intronic
1062821503 10:537587-537609 TGCCCAGGGCACCCAGGACACGG + Intronic
1062929710 10:1344833-1344855 CCCCCAGCACAGCCAGGCTGAGG - Intronic
1063101076 10:2950763-2950785 CACCAAGGTCAGCCATGCCAGGG + Intergenic
1063179586 10:3585654-3585676 CGGCCGGGCCAGCAAGGCCAAGG + Intergenic
1063466137 10:6246068-6246090 AACCCAGGGCATCCAGGCCATGG - Intergenic
1064571244 10:16695514-16695536 GGCCCAGATCAGCCAGGACAAGG - Intronic
1065636599 10:27741870-27741892 CTGCCAGGCCTGCCAGGCCAGGG - Intronic
1066745610 10:38602732-38602754 GTCCCAAGAGAGCCAGGCCACGG + Intergenic
1067098631 10:43318839-43318861 AGCACAGCACAGCCAGGACATGG - Intergenic
1067560225 10:47300210-47300232 CGCACACGGCAGCCGGGCCAGGG + Intergenic
1067570856 10:47369803-47369825 TGCCCAGGACAGTGAGGGCATGG - Intronic
1067829936 10:49605770-49605792 CACCGAGGACAGGCTGGCCAAGG + Intergenic
1070539823 10:77408036-77408058 CACCCAGGACAGCTGGGGCAGGG + Intronic
1070587872 10:77780113-77780135 CTCCCAGGGCAGCCTGGCCCAGG + Intergenic
1070963075 10:80512470-80512492 CACCCAGAACACCAAGGCCAGGG - Intronic
1071299785 10:84247806-84247828 GGCCCTGGGCAGCCAGGCCAAGG + Intronic
1072618854 10:97066943-97066965 CACCCACCACAGCCAGCCCAGGG - Intronic
1072805899 10:98423967-98423989 CACCCAGGACAGACAGACCTGGG + Intronic
1073259253 10:102176195-102176217 AGCCCAGGCCATCCAGCCCAGGG - Intergenic
1075045494 10:119143173-119143195 GGGCCTGCACAGCCAGGCCAAGG - Intronic
1075094423 10:119461425-119461447 CCCCCAAGATAGCCAAGCCAAGG - Intergenic
1076034550 10:127188186-127188208 AGCACAGCCCAGCCAGGCCAGGG - Intronic
1076079074 10:127561679-127561701 GGCTCAGAACAGCCAGGACATGG + Intergenic
1076125604 10:127971530-127971552 CTGCGAGGACAGCAAGGCCAGGG - Intronic
1076701511 10:132275596-132275618 GTCACAGCACAGCCAGGCCACGG + Intronic
1077059261 11:610557-610579 CGCACTGGTCAGCCAGCCCACGG + Exonic
1077189951 11:1251796-1251818 CTCCCAGGACAGGCAGACCCAGG - Intronic
1077239820 11:1504692-1504714 AGTCCAAGACAGCCAGGGCAGGG + Intergenic
1077350429 11:2090700-2090722 AGCCCTGGACAGCCAAGCCCTGG - Intergenic
1077369797 11:2176120-2176142 TGCACACCACAGCCAGGCCATGG - Intergenic
1077465877 11:2733436-2733458 CGCCCAGGGAAGCCAAGCCGTGG - Intronic
1078774443 11:14381418-14381440 CTGCCAGGACGGCCTGGCCAGGG - Intergenic
1080029533 11:27646282-27646304 TGCCCAGCTTAGCCAGGCCACGG - Intergenic
1081578470 11:44334605-44334627 CTCCCAGGACAGCGAGTCCTTGG - Intergenic
1083171606 11:60926756-60926778 TGCCCAGCAGAGCCTGGCCAAGG + Intronic
1083333964 11:61912241-61912263 CGCCCCGGGGAGCCAGGCCCTGG - Intronic
1083339545 11:61950191-61950213 CGGCTAGCACAGCCTGGCCATGG - Intronic
1083724176 11:64619754-64619776 CTGCCAGGACTGCCAGGCCAAGG - Intronic
1083926259 11:65808902-65808924 CGCCCAGGCCACCCAGGCTGTGG + Intergenic
1084492524 11:69486586-69486608 CCCCCAGGACAGCGAGGGGAGGG - Intergenic
1084554918 11:69869773-69869795 AGCCCAGGCCAGCCAGGGCACGG - Intergenic
1084573805 11:69975951-69975973 CGCAGAGGACAGCAAGGCCAAGG - Intergenic
1084603515 11:70160101-70160123 CTCCCAGGACAGGCAGGCCCAGG - Intronic
1084793999 11:71492022-71492044 AGCCCTGGGCACCCAGGCCAGGG - Intronic
1085048606 11:73367942-73367964 CCCACTGGCCAGCCAGGCCATGG + Exonic
1085464039 11:76712364-76712386 CGCCCAGGGCGCCCAGGCCCCGG + Intergenic
1088619944 11:111671555-111671577 CTCCAATCACAGCCAGGCCAAGG - Intronic
1089362569 11:117900809-117900831 AGCCCAGCTCAGGCAGGCCATGG - Intronic
1089554883 11:119310820-119310842 CGCCCAGCACCGCCAGGACCAGG + Exonic
1090029679 11:123195905-123195927 GCCCCAGGAAAGCCAGGCCAAGG - Intergenic
1090398755 11:126435333-126435355 CACCCTGGCCAGCCAGGCCCTGG - Intronic
1091222587 11:133937914-133937936 CCCCCAGTACATCGAGGCCAAGG - Exonic
1091397688 12:163668-163690 CGCCCTGGTCAGCCTGGGCAGGG + Intronic
1091697879 12:2640290-2640312 TGCCCAGGCCAGCCTGGCCCAGG - Intronic
1092944650 12:13441483-13441505 CTCCCAGCACAGCCATGCCAGGG - Intergenic
1094046188 12:26169628-26169650 CTTTCAGGACAGCCAGGCTATGG + Intronic
1095967984 12:47882438-47882460 CGCACAGGAGAGCCCAGCCAGGG + Intronic
1096490690 12:52011152-52011174 AGCCCAGGACACCCAGGTCTGGG + Intronic
1096557927 12:52415152-52415174 GGGCAGGGACAGCCAGGCCAGGG + Intergenic
1097166399 12:57088787-57088809 CGCCCTGCACAGCCGGGCCTCGG + Intergenic
1097225425 12:57474422-57474444 TTCCCAGAACAGCCAGGACAAGG - Exonic
1101136093 12:101744513-101744535 CGGCAAGGACACCAAGGCCACGG - Intergenic
1102029412 12:109731367-109731389 CCCACAGCACAGCCATGCCATGG + Intronic
1102215897 12:111161117-111161139 AGCCCAGGGCAGCCAGGCAAGGG - Intronic
1103711773 12:122918085-122918107 CACCCCGGGCAGCCAGGCCTGGG - Intergenic
1103954013 12:124566842-124566864 CCTCCACAACAGCCAGGCCAGGG + Intronic
1104795375 12:131513453-131513475 CCCCGTGGACAGCCAGGGCATGG - Intergenic
1104857505 12:131908981-131909003 CACCCGGCACAGCCCGGCCAAGG - Intronic
1106680443 13:32001691-32001713 CAGCCAGAACAACCAGGCCATGG - Intergenic
1107410285 13:40151926-40151948 CACCTAGGGAAGCCAGGCCAGGG + Intergenic
1110563473 13:76934691-76934713 CATCCAGGACAGTCTGGCCATGG + Intergenic
1113880157 13:113620340-113620362 CGTCCTGAACAGCCAGGCCACGG - Intronic
1113928482 13:113953885-113953907 TGTCCAGGACAGCCCGTCCAGGG + Intergenic
1118471000 14:66075242-66075264 CCCCGAGGAAAGCCAGGACAAGG + Intergenic
1119147936 14:72333353-72333375 TGGGCAGGACAGCCAGCCCAGGG + Intronic
1119613065 14:76080168-76080190 CAGCGATGACAGCCAGGCCAAGG - Intronic
1119824625 14:77647190-77647212 CAGCAAGGACAGCCAGGCCCTGG - Intergenic
1120859349 14:89240889-89240911 CTCCCAGGACTCCCAGCCCAGGG + Intronic
1121332136 14:93056281-93056303 CACCAAGAACCGCCAGGCCAAGG + Intronic
1121563851 14:94894151-94894173 CGCTCAGCTCAGCCAGGACAGGG + Intergenic
1122148215 14:99706764-99706786 CGCCATGGACATCCTGGCCAAGG + Exonic
1122325948 14:100880768-100880790 CGCCTGGGAGAGCCAGCCCAGGG - Exonic
1122724178 14:103739730-103739752 CTCCCAGCACAGCCTGACCAAGG + Intronic
1122974892 14:105167044-105167066 CTCCCAGCACGCCCAGGCCAGGG + Intronic
1123033740 14:105463376-105463398 CGGAGAGGACAGCCGGGCCAGGG - Intronic
1124960077 15:34387223-34387245 CACCCAGGACACCCAGGATATGG - Intronic
1124976706 15:34533444-34533466 CACCCAGGACACCCAGGATATGG - Intronic
1125759466 15:42087151-42087173 CACACAGCACAGACAGGCCAGGG + Intronic
1127664746 15:61134710-61134732 CGCCAAGGACAACCAGAACAAGG - Intronic
1127776494 15:62268011-62268033 CACCCAGGACACCCAGGAAATGG - Intergenic
1127996084 15:64153759-64153781 GGCCCAGGCCAGACAGGCCCAGG - Intronic
1129266393 15:74395734-74395756 AGCCCAGGAGAGCCAGCCCCAGG + Intergenic
1129513777 15:76144101-76144123 TGGCCAGGACAGGCAGGCCATGG - Intronic
1129664822 15:77573694-77573716 TGCCCTGGACTGCCAGCCCAGGG - Intergenic
1130484317 15:84390162-84390184 CACCCAGGACACCCAGGAAATGG + Intergenic
1132206414 15:99989008-99989030 TGCTGAGGACAGCCAGGCCTTGG + Intronic
1132610532 16:813742-813764 CGCCCAGGGCAGGCAGGCAGGGG - Exonic
1132667531 16:1089074-1089096 ACCCCAGGGCAGCCGGGCCAGGG + Intergenic
1132684250 16:1155674-1155696 GGGACAGGACAGCCAGGCCCGGG - Intronic
1133050263 16:3113451-3113473 CATCCAGGACACCCAGGACAAGG + Exonic
1134077697 16:11303652-11303674 TCCCAAGGACAGGCAGGCCACGG + Intronic
1135559805 16:23467598-23467620 CGCCCAAGACAGCCAGGTCTGGG + Exonic
1136390843 16:29963230-29963252 GGCCCAGGCCAGAGAGGCCAAGG - Exonic
1138410936 16:56839750-56839772 CTCACAGAAAAGCCAGGCCAAGG - Intronic
1139513335 16:67439558-67439580 CACCCAGGAGTGCCAGGGCAGGG + Intronic
1139648826 16:68351548-68351570 AGCCCAAGGCAGCCAGGACAGGG - Intronic
1141948023 16:87323594-87323616 AGCTCAGGACAGCCAGACCTGGG + Intronic
1142150933 16:88512262-88512284 AGCCCAGGGCTGCCAGGACAGGG + Intronic
1142231526 16:88902337-88902359 CGCCCAGCGCAGCCAGGCCTCGG - Intronic
1142808326 17:2383372-2383394 CTCCCATGACAGCCTGCCCAGGG + Intergenic
1142872269 17:2828621-2828643 GGCCCAGGACTGCCCGGGCATGG + Intronic
1142898708 17:2999004-2999026 TGTCCAAAACAGCCAGGCCAGGG - Intronic
1143178059 17:4967891-4967913 CGCCCAGGCCAGGCGGGCCCAGG - Intergenic
1143379557 17:6487523-6487545 CGCCCAGCCCAGCAAGGCCGAGG - Intronic
1143651763 17:8267607-8267629 CGCCCACGAAGGCCACGCCACGG - Exonic
1144254765 17:13456556-13456578 CGTTCAGGACATCCATGCCATGG - Intergenic
1144685605 17:17224047-17224069 CATCAAGGACAGCCTGGCCAGGG - Exonic
1144727212 17:17507918-17507940 GGCTCGGGGCAGCCAGGCCAGGG - Intronic
1144829313 17:18122597-18122619 TGCCCAGCACAGGCAGGCCCAGG + Intronic
1146927904 17:36757655-36757677 GGCCCAGGAAAGCCATGCCTGGG + Intergenic
1147161484 17:38571800-38571822 GGCCCAAGGAAGCCAGGCCAGGG + Intronic
1147331218 17:39700446-39700468 CGCTCAGGGCAGCCGGGCCCTGG + Intronic
1147350106 17:39835573-39835595 CGCCAACCGCAGCCAGGCCAAGG - Intronic
1147668529 17:42163712-42163734 GGCCCTGGCCAGCCAGGGCAGGG + Exonic
1148109408 17:45136334-45136356 CCCCCAGGACAGCCCAGGCAGGG - Intronic
1148125332 17:45233678-45233700 CGAGCAGCACATCCAGGCCACGG - Exonic
1148331586 17:46817054-46817076 CTCCCAGGACAGCCAGCCAAGGG - Intronic
1148562540 17:48614211-48614233 CGCCCCGGCCTGCCAGGCCTTGG + Intronic
1148793181 17:50184968-50184990 CGCCCAGCACCCCCAGGCCCTGG - Exonic
1148972934 17:51500110-51500132 CTGCAAGGGCAGCCAGGCCAAGG - Intergenic
1150624901 17:66835350-66835372 CCCCCATGACAGCCCAGCCAGGG + Intronic
1151355856 17:73558066-73558088 CCCCCAGGGCACCCAGCCCATGG - Intronic
1152139785 17:78529678-78529700 CTTCCAGGTCAGCCAGGCTAAGG + Exonic
1152183575 17:78840486-78840508 CGGCGAGGACAGCCCGGCCCCGG + Exonic
1152554361 17:81045684-81045706 GGCCCTGGGCAGCCTGGCCATGG - Intronic
1152711018 17:81870701-81870723 CACCCGGGACACCCAGGCCGGGG + Intronic
1152807330 17:82362406-82362428 AGCCCAGGACAGCCTGTGCAGGG + Exonic
1152820866 17:82437047-82437069 CGCCTGAGACAGCCAGGCCCGGG - Intronic
1152924467 17:83080811-83080833 GGCCCGGGCCAGCCCGGCCACGG - Intronic
1152931371 17:83111807-83111829 CGCGCAGGGCAGCCAGGTCCCGG + Intergenic
1154256892 18:12789567-12789589 CGTCCAGCACAGCCAGGCGAGGG + Intronic
1155695872 18:28685878-28685900 GGCACAGAATAGCCAGGCCATGG - Intergenic
1156486914 18:37472205-37472227 CTTCCAGCACAGCCAGGCCTTGG + Intronic
1157761467 18:50268516-50268538 GCCCCAGGGCGGCCAGGCCAGGG + Intronic
1158092222 18:53727646-53727668 TGCGCAGGGCAGCCAGGCCCTGG + Intergenic
1160072205 18:75638893-75638915 AGCGCGGGACAGACAGGCCATGG + Intergenic
1160110452 18:76024757-76024779 CTCCCAGGACAGCCTGGACCTGG - Intergenic
1160679838 19:407614-407636 CGCCCAGGACAGCCAGGCCAAGG - Exonic
1160764787 19:802588-802610 CGCCCAGGCCCCCCAGGACAGGG - Intronic
1161045563 19:2132600-2132622 CACCCAGGGCATCCTGGCCACGG - Intronic
1161051149 19:2164519-2164541 CGCCCGGGACAGCCCGGCGGGGG - Intronic
1161104099 19:2434715-2434737 CGCCCCGCACATCCAGGGCAGGG + Intronic
1161397506 19:4052433-4052455 CGCCCAGGAGTGCCAGGCAGGGG - Intronic
1161470707 19:4455637-4455659 AGCCCAGGGGAGACAGGCCACGG - Intronic
1161767072 19:6213867-6213889 CTCCTAGGACAGCCCGGCCCAGG + Intronic
1162007097 19:7787913-7787935 CGACCAGGACAGCCATGGCCAGG - Intergenic
1162295572 19:9811129-9811151 CCTCCAGCACAGCCAGGCCAGGG + Exonic
1162926192 19:13931632-13931654 GGCCCAGGAGAGCCAGACCAAGG + Intronic
1163025076 19:14506087-14506109 GGCCCTGGACACACAGGCCAAGG - Intergenic
1163434383 19:17286525-17286547 TCCCCAGGACATCCAGGCCCGGG + Exonic
1164156009 19:22597686-22597708 CACCCAGGACACCCAGGAAATGG + Intergenic
1164502098 19:28828727-28828749 AGCCCACGGCACCCAGGCCATGG + Intergenic
1164816960 19:31211680-31211702 AGCCCAGGCCAGCCAGACCCTGG + Intergenic
1165758500 19:38307692-38307714 CTCCAGGGTCAGCCAGGCCAGGG + Exonic
1166373439 19:42314606-42314628 TCCCCAGGACTGCCTGGCCAAGG + Exonic
1166677422 19:44748490-44748512 CGCCTGGGGCAGCCAGGCCTCGG - Intronic
1167427254 19:49435808-49435830 CTCCCAGGACTGGGAGGCCAAGG + Intronic
1168011753 19:53538581-53538603 CGCCCAGCACGGCCATGCTACGG - Intronic
1202712061 1_KI270714v1_random:24188-24210 CACCCAGCACAGCCAGGGCTGGG - Intergenic
925930827 2:8706426-8706448 CTCCCAGGACAGCCAGCTCCTGG + Intergenic
926251008 2:11155427-11155449 CGCCCGGGACCACCCGGCCAGGG - Exonic
926724157 2:15984478-15984500 CGCCCCGCACAGCCCAGCCAAGG - Intergenic
927509171 2:23633857-23633879 CGCTGAGGACATGCAGGCCACGG - Intronic
927929090 2:27032850-27032872 CGCTCAGGAGAGCCCGGCCCAGG + Intergenic
928305890 2:30170121-30170143 CGACCAGGAGTGCCTGGCCAAGG + Intergenic
928437915 2:31267802-31267824 CTCCCAGGACAGGCTGGCAAGGG + Exonic
932015643 2:68023927-68023949 CCTCCAGGACAGCCAGGCCAGGG + Intergenic
932597371 2:73102362-73102384 TGCTCAGGTCAGCCTGGCCATGG - Intronic
933813414 2:86047635-86047657 CGCCCAGCAGAGCCTGGCCTGGG + Intronic
935313345 2:101806939-101806961 CGCCAGGGCCAGCCAGGCCCAGG - Intronic
936049860 2:109214494-109214516 AGCCCAAGCCAGCCAGGCCCTGG + Intronic
937237735 2:120440985-120441007 CCACCAGCACAGGCAGGCCATGG - Intergenic
937244728 2:120485275-120485297 GGCCCAGGAGAGGCAGGCCAGGG + Intergenic
937453727 2:122023655-122023677 CGCCCAAGCCAGCCAAGACAGGG - Intergenic
939629827 2:144517481-144517503 CGCCCAGGGGAGCCGGGCCAGGG + Intronic
940517505 2:154699050-154699072 CGCCATGAAAAGCCAGGCCACGG - Exonic
941384850 2:164841088-164841110 CGGCGAGGACAGCGAGGCCTCGG - Intronic
941812457 2:169768255-169768277 CGCCCAGGGGAGCCCGGCCAAGG - Intronic
944581618 2:201137296-201137318 CTCCCAGGGCAGCCTGGCCCAGG + Intronic
945080777 2:206085263-206085285 CGCTCCGGACGGCCAGGCCGGGG - Intronic
945770425 2:214035391-214035413 CGCCCAGGCCATTCATGCCAAGG + Intronic
946248852 2:218401182-218401204 TGCTCAGGACAGCCAGGGCCTGG - Intronic
946907226 2:224429058-224429080 CCCCCAGGAGATCCAGCCCAGGG - Intergenic
947591509 2:231388662-231388684 CGCCCTGGACAGCTGGGCCCAGG - Intergenic
947984447 2:234436797-234436819 GGCTCAGGACAGCCAGCACAGGG - Intergenic
948629321 2:239291989-239292011 AGCTCAGGACAGCCACGCCAGGG + Intronic
948629346 2:239292087-239292109 AGCTCAGGACGGCCACGCCAGGG + Intronic
948804763 2:240448686-240448708 CGCCCAGGGCTCCCAGCCCAGGG - Intronic
1170574697 20:17653533-17653555 CGCCAAGAACAGCCTGGCCCTGG + Intronic
1171372947 20:24673451-24673473 AGCCCAAGTCAGCCAGGTCATGG + Intergenic
1172118322 20:32584203-32584225 CGCCCGGGACAGGCAGCCCCGGG + Intronic
1173342071 20:42161697-42161719 CTACCAACACAGCCAGGCCAGGG - Intronic
1173619931 20:44429205-44429227 CGCTGGGGACAGCCAGGCCTGGG + Intronic
1174295014 20:49539657-49539679 CACCCATGAAAGCCAGGCCCAGG - Exonic
1174343866 20:49915391-49915413 CGCCGAGGACGGCCCGGCCGAGG + Intronic
1174404061 20:50292518-50292540 CTCCCAGGGCAGCCTGGCCCAGG - Intergenic
1174452451 20:50628693-50628715 CTCCCAGGACAGCAGGGCCTGGG + Intronic
1175184691 20:57172198-57172220 AGCACAGCACATCCAGGCCAGGG + Intronic
1175258550 20:57661411-57661433 TGCCCAGGACACCCTGCCCAAGG + Intronic
1175367742 20:58467331-58467353 CGCCCCAGGCAGCCAGGCCCGGG + Exonic
1175409064 20:58754113-58754135 CACCCAGGAGAACCAGGCCATGG + Intergenic
1175608413 20:60330216-60330238 CCCCCAGAACTGCAAGGCCATGG + Intergenic
1176041179 20:63066660-63066682 CCCCCAGGGCAGCCACGCCTGGG + Intergenic
1176198446 20:63848454-63848476 GGCCCAGGACAGGAAGCCCAGGG + Intergenic
1176271209 20:64236109-64236131 CACCCACCACAGCCAGCCCAGGG - Intronic
1176271243 20:64236205-64236227 CACCCACCACAGCCAGCCCAGGG - Intronic
1178587262 21:33880838-33880860 GGCCAAGGATAGCAAGGCCATGG - Intronic
1179779293 21:43689103-43689125 CGCCCTGGGCTTCCAGGCCAGGG + Intronic
1179830292 21:43992285-43992307 CACCCAGGACAGACATGCCGTGG - Intergenic
1179963003 21:44781422-44781444 TGCCCAGGACAGCAGGACCAAGG + Intronic
1179998841 21:44986113-44986135 GGCCCAGGCCAGCCCGGGCAGGG + Intergenic
1180150151 21:45943222-45943244 GGCCCAGGACAGCCTGCCCCAGG + Intergenic
1180169681 21:46051238-46051260 CTCCCAGGCCAGCCAGCCCCGGG - Intergenic
1180839969 22:18954697-18954719 CCCCCAGGACACCCAGGCCCTGG + Intergenic
1180934170 22:19613304-19613326 GGCCAAGGACAGCCATGCCGTGG - Intergenic
1181271021 22:21658435-21658457 AGCCCAGTGCAGCCAGGCCGAGG + Intronic
1181345389 22:22216399-22216421 TGCCTAGGAGAGCCTGGCCAGGG + Intergenic
1181897830 22:26126376-26126398 CACCCAGGAAGGCCAGGCCCTGG + Intergenic
1182451376 22:30423764-30423786 CGCTCAGGACATCCCGGCCTGGG + Exonic
1183188918 22:36309062-36309084 CGCCCAGGAGGACCCGGCCACGG + Intronic
1183776919 22:39972238-39972260 AGCACAGGTCAGCCTGGCCAGGG + Exonic
1184058628 22:42068489-42068511 TTCCCAGGCCAGCCAGCCCATGG + Exonic
1184256506 22:43290056-43290078 AGCTCACGACAGCCAGGCCCTGG + Intronic
1184722996 22:46326313-46326335 AGCCCAGAAGAGCCAAGCCAGGG - Intronic
1184750683 22:46484568-46484590 AGCCCGGGACAGCCTGGCAAGGG + Intronic
1185269668 22:49923184-49923206 GGCCCAGGACAGCCCGGCCAGGG - Intronic
1185389030 22:50548997-50549019 CGCCCAGCACCGCCCGGCCCCGG - Exonic
949265974 3:2156485-2156507 CGCCGAGGACATCCACACCAGGG - Intronic
950042933 3:9931919-9931941 CACCCAGGACAGCAAGATCAAGG + Intronic
950161492 3:10764294-10764316 CCCCCGGGCCAGCCAGGCCCGGG + Intergenic
950163266 3:10775472-10775494 AGCCCTCTACAGCCAGGCCAAGG - Intergenic
950535213 3:13574581-13574603 CCCCCAGCCCAGCCAGGCCTGGG + Intronic
950831531 3:15879768-15879790 CTCCCAGGGCAGCCTGGCCCAGG - Intergenic
953605278 3:44409723-44409745 CTGCCAGGACAGCCTGGGCAGGG - Intergenic
953607505 3:44421242-44421264 CGGCCAGCAGAGCCTGGCCACGG + Intergenic
954314640 3:49794570-49794592 CGGCCTGGACACCCAGGACAAGG - Intronic
954369784 3:50164098-50164120 AGCCTGGGTCAGCCAGGCCAGGG + Intronic
954653786 3:52181666-52181688 CACCCAGGAGGGCCAGGACAGGG + Intergenic
956973616 3:74554910-74554932 TGGCCAGGACAGTCAGGCAAGGG - Intergenic
961591542 3:127985189-127985211 CGCCCAAGCCACCCAAGCCAGGG + Exonic
965310031 3:167116202-167116224 CACTCCTGACAGCCAGGCCAGGG - Intergenic
966437478 3:179904867-179904889 CAACCAGGACAGCCACTCCAGGG - Intronic
968047240 3:195631264-195631286 CGCACAGCACAGCCAGGACATGG - Intergenic
968307372 3:197658660-197658682 CGCACAGCACAGCCAGGACATGG + Intergenic
968353268 3:198080461-198080483 AGCCCAGGACCGCCCGGCCCGGG + Intergenic
968460915 4:724309-724331 CGGCCATGCCAGCCAGGTCAGGG + Intronic
968922260 4:3528469-3528491 GCCCCAGGAAACCCAGGCCAGGG + Intronic
968949780 4:3684435-3684457 CGACCAGCACAGACAGGCCCTGG - Intergenic
969399287 4:6943262-6943284 CGCCCAGGACAACGAGGAAATGG + Intronic
969409623 4:7019588-7019610 CTCCCACTTCAGCCAGGCCAGGG - Intronic
969632172 4:8345192-8345214 CTCCCAGGGCAGCCCGGCCGTGG + Intergenic
976116798 4:81736557-81736579 CTCCCAGGACTGGCAGGCCATGG - Intronic
976146880 4:82050864-82050886 CATCCAGGACAGCCAGAGCAGGG - Intergenic
977928707 4:102729341-102729363 CGCCAACTGCAGCCAGGCCAAGG - Intronic
979745473 4:124207078-124207100 TGCCTAGGGCAGCAAGGCCATGG + Intergenic
981516207 4:145612817-145612839 CGCCCTGGGCAGCAAGCCCACGG - Intergenic
985164914 4:187082818-187082840 AGCCCAGGAGAGCAAGGCTACGG + Intergenic
985170445 4:187143327-187143349 TGCACAGGACAGGCAGGGCAGGG + Intergenic
985377855 4:189360846-189360868 CGCTCAGGGAAGCCAGGCCAGGG - Intergenic
985744376 5:1637925-1637947 CGCACAGCACAGCCGGGACATGG + Intergenic
985761834 5:1752957-1752979 TGGCCAGGACAGCCAGGCGGTGG + Intergenic
985770021 5:1803804-1803826 TGCCCAGGACAGCCTGCACACGG - Intronic
985812957 5:2103584-2103606 AGCCCAGGCCGGCCAGGCCCCGG - Intergenic
985815602 5:2125667-2125689 GGCCCAGGAGGGGCAGGCCAAGG + Intergenic
985863820 5:2495715-2495737 AACCCAGGAGACCCAGGCCAAGG + Intergenic
985949131 5:3209935-3209957 GGCCCAGGACATCCAGTCCAGGG - Intergenic
992762521 5:79963075-79963097 GGGTCAGGACAGCCAGGCAAGGG + Intergenic
997120020 5:131164624-131164646 CGCCCAGGAACGCCGGGCCCTGG + Intronic
997283709 5:132663909-132663931 CAGACAGGACAGCCTGGCCAGGG + Intergenic
997693927 5:135846452-135846474 GGCCCAGGACAGCCAGGGCATGG + Intronic
999233749 5:150078324-150078346 GGGCCAGGACACACAGGCCAGGG + Intronic
1000097813 5:157986605-157986627 CTCTAAGGCCAGCCAGGCCAAGG - Intergenic
1002433230 5:179216307-179216329 TGCCCAGGAGAGCCTGGCCTAGG + Intronic
1002465210 5:179404950-179404972 GGCCTAGTGCAGCCAGGCCAGGG - Intergenic
1002592254 5:180298955-180298977 TGCCCAGGAGAGCCTGGCCTAGG + Intergenic
1003128445 6:3374761-3374783 CACCCAGCACAGCCAGCCCTGGG + Intronic
1004508807 6:16267877-16267899 CGCCCTGGAGATCCAGCCCATGG - Intronic
1004731839 6:18366516-18366538 CTCCCAGGGCAGCCTGGCCCAGG + Intergenic
1006103858 6:31704080-31704102 CGTCCAGGAGTTCCAGGCCATGG + Intronic
1006764393 6:36492048-36492070 AGCCCAGGAGAACCAGGACAAGG + Intergenic
1007430758 6:41775418-41775440 CGCCGATGTCAGACAGGCCAGGG - Exonic
1007548802 6:42713381-42713403 CACCCAGGACCACCAGGCCAGGG + Intronic
1008482660 6:52002522-52002544 CCTCCAGGACAGCCAGGTCAGGG + Intronic
1011544471 6:88468729-88468751 TGCACAGGGCAGCCAGGCCCTGG - Intergenic
1017609995 6:156175322-156175344 CCCCCTGGACAGCCAGTCCGTGG - Intergenic
1017673894 6:156794504-156794526 CTCCCAGGCCTCCCAGGCCAAGG - Intronic
1018150298 6:160931224-160931246 AGCCCATGATGGCCAGGCCAAGG + Intergenic
1018169520 6:161133600-161133622 CTTCCAGGAAAGCCAGCCCACGG - Exonic
1018390162 6:163335812-163335834 CACCCAGGCCAGCCACGTCATGG - Intergenic
1018813953 6:167317231-167317253 CTCCCTGATCAGCCAGGCCAGGG - Intergenic
1019432185 7:1004221-1004243 CACCCGGGCCAGCCAGGCCATGG + Intronic
1019523184 7:1469577-1469599 CTCCCAGGTCAGCCAGGCCCCGG - Intergenic
1020257552 7:6510520-6510542 GGCCCAGGAGACCCAGGCCAAGG - Intronic
1020431906 7:8123701-8123723 CGACCAGGATGCCCAGGCCAGGG + Intronic
1020643148 7:10780254-10780276 CTCCCACGACAGCAAGGCCATGG + Intergenic
1020716422 7:11679342-11679364 TGGCCAGGGCAGCCAGGCAAGGG + Intronic
1022451935 7:30523741-30523763 CACCCAGGACACCCAGGATATGG - Intronic
1023992113 7:45134537-45134559 AGCCCAGGAGACCCAGGCCCCGG - Intergenic
1024224831 7:47318518-47318540 AGCACAGGGCAGTCAGGCCAGGG + Intronic
1025769973 7:64495287-64495309 CGCCCAGGCCAGGGACGCCACGG - Intergenic
1026453956 7:70554709-70554731 TGCCCTGTGCAGCCAGGCCAGGG + Intronic
1026673862 7:72412889-72412911 CTACCAGGAAAGCCAGGCCTGGG - Intronic
1027620194 7:80475068-80475090 TCCCCAGGAGAGCCAGGTCAGGG - Intronic
1029110813 7:98212285-98212307 CTCCTAGGACAGCCAGTCCAGGG + Exonic
1029139786 7:98401304-98401326 CGGACAGGGCAGCGAGGCCACGG + Intergenic
1029436335 7:100566060-100566082 AGCCCAGCAGAGCCAGGTCAAGG - Exonic
1029477565 7:100794056-100794078 CGCCAAGGAGAGCCAGACCAGGG + Intronic
1029551729 7:101240178-101240200 GCCCCAGAACAACCAGGCCAAGG - Exonic
1030108086 7:106003762-106003784 TTCCCAGGAGAGCCAGGCAAAGG + Intronic
1031813293 7:126399706-126399728 CACCCAGGACAGAAAGGTCAAGG - Intergenic
1032018183 7:128392789-128392811 CTCCCAGGGCAGCCTGGCCCCGG + Exonic
1034491285 7:151394357-151394379 CCCATAGGAGAGCCAGGCCAGGG - Intronic
1034885264 7:154794126-154794148 CGCCCGGTTCAGCCAGGTCACGG - Exonic
1035070695 7:156143355-156143377 CCCGCAGGGCAGCCAGGGCACGG - Intergenic
1035243558 7:157547896-157547918 CGCCCAGGGCGGCCACGCGAGGG - Intronic
1035274177 7:157737572-157737594 GGCCCAGAGAAGCCAGGCCAGGG - Intronic
1035384123 7:158459061-158459083 AGCCCAGGGCAGCCACACCAAGG - Intronic
1035751634 8:2001174-2001196 AGCGCAGCACAGCCCGGCCATGG + Exonic
1036432427 8:8702836-8702858 CGCCCCGGCCAGCCCGGTCACGG + Exonic
1036910483 8:12754418-12754440 CGCGCCCGACAGCCAGGCCGCGG + Intronic
1037802036 8:22041158-22041180 CCCCCAGGTAAGCAAGGCCAGGG + Intergenic
1037812501 8:22095332-22095354 CGCCCAGGACAGCCCCGCGCAGG - Intronic
1038614131 8:29077076-29077098 GGCCCAGGACAGCTAGGACCAGG + Intronic
1041371949 8:57171229-57171251 GGACAAGGACAGCCAGACCATGG - Intergenic
1043341945 8:79250555-79250577 CACCCAGGAGAGCCAGATCATGG - Intergenic
1043734266 8:83724310-83724332 CGCCCAGGTCGTCCATGCCAAGG + Intergenic
1044447183 8:92292813-92292835 TGCCCAGGGCAGTCAGGCAAAGG - Intergenic
1046958280 8:120083757-120083779 TGCCCATGACAGTCAGGCCCTGG - Intronic
1047251200 8:123183057-123183079 GGCCCAGTACATCCAGGCCCAGG + Exonic
1047275539 8:123402302-123402324 CTCCCAGGGCAGCCTGGCCCAGG - Intronic
1047330761 8:123884759-123884781 CGGCAAGGCCAGCCAGGGCAGGG - Intronic
1047946625 8:129887171-129887193 TCCCCAGGGCAGCCAGGCCCTGG - Intronic
1049298322 8:141855638-141855660 CGTCCAAGAAAGCCAGGGCACGG + Intergenic
1049311353 8:141935497-141935519 CAACCAGGGCAGCCAGGACAAGG + Intergenic
1049529360 8:143146761-143146783 TGCCCAGGAGAGGCAGGCAATGG + Intergenic
1049598680 8:143497254-143497276 TTCCCAGAACAGCCAGGACAGGG + Intronic
1049762372 8:144337164-144337186 CTCCCAGGAGACCCAGGCCGGGG - Intergenic
1049763893 8:144343980-144344002 AGCCCAGGACGGCTGGGCCAGGG - Intergenic
1049812493 8:144581763-144581785 CCCCCAGATCAGCAAGGCCAAGG + Intronic
1050698938 9:8314895-8314917 CGGCGAGGACAGCCAGGGGAGGG - Exonic
1052941158 9:34132963-34132985 CTCCCAGGGCAGCCTGGCCCAGG + Intergenic
1057039852 9:91840132-91840154 CTCCCAGGACAGCGGGGCCTCGG - Intronic
1057131745 9:92658812-92658834 CCCCCAGGGCAGGGAGGCCAGGG + Intronic
1057189160 9:93076817-93076839 TGCCCAGCAGAGCCATGCCAGGG - Intronic
1059246067 9:112850711-112850733 CTCCTAGGACAGTCTGGCCATGG - Intronic
1060665722 9:125431038-125431060 GGCCAAGGACAGCCAGGGGAAGG - Intergenic
1060759655 9:126236454-126236476 CCCCCAGCTCAGCCAGGCCCGGG + Intergenic
1060814406 9:126627087-126627109 AGGTCAGGACAGCCTGGCCAAGG - Intronic
1060824999 9:126682962-126682984 ATCCCAGGCCAGCCTGGCCAGGG - Intronic
1060889601 9:127179599-127179621 CACCCAAGACTTCCAGGCCAAGG + Intronic
1060964864 9:127706829-127706851 GGCCCAGGAGTCCCAGGCCATGG - Intronic
1061028115 9:128063592-128063614 TGCCCAGGAGCGCCAGGCCCAGG - Exonic
1061056180 9:128224182-128224204 CGGCCAGGAGGGCCAGGCCGAGG - Intronic
1061065210 9:128273544-128273566 CACCCAGGACACCCAGGAAATGG - Intronic
1061369646 9:130191262-130191284 CGGGCAGGAGAGCCAGGCCTGGG + Intronic
1061493926 9:130961091-130961113 GGCCCAGGACAGCTGAGCCAGGG + Intergenic
1061675092 9:132211112-132211134 AGCCCAGGGCAGTCAAGCCAAGG - Intronic
1061807075 9:133142573-133142595 CTCCCAGGGCAGCCAAGCCAGGG - Intronic
1061876476 9:133546588-133546610 CACCCATGCCAGCCAGGCCAGGG + Intronic
1061972206 9:134050855-134050877 GGCCCTTGACTGCCAGGCCATGG - Intronic
1062358486 9:136176365-136176387 TGCCCAGGACAGCCTGGCCCTGG - Intergenic
1062615003 9:137392375-137392397 TGCCCCCGACAGCCAGGCCTGGG - Intronic
1203375754 Un_KI270442v1:375380-375402 AGCACAGGGCACCCAGGCCAAGG - Intergenic
1185652388 X:1657800-1657822 CACCCAAGACAGGCAGGCCTGGG - Intergenic
1186461858 X:9754341-9754363 CTCCCAGCCCAGCCAGGCTAGGG - Intronic
1189355637 X:40308098-40308120 CAGCCAGGACTGTCAGGCCAGGG + Intergenic
1189658990 X:43277901-43277923 CTCCCAGGGCAGCCTGGCCCAGG + Intergenic
1190629212 X:52368761-52368783 CCCCCACCACAGCAAGGCCATGG - Intergenic
1190685394 X:52868372-52868394 CCCCCACGACAGCAAGGCCATGG + Intergenic
1190700884 X:52989307-52989329 TGCTCAGGACAGTCAGGCGAGGG - Intronic
1190953711 X:55171395-55171417 CTCCCATGACAACAAGGCCATGG - Intronic
1191000835 X:55658256-55658278 CCCCCACGACAGCAAGGCCAAGG + Intergenic
1195085263 X:101407760-101407782 CTCCCAGTGCAGCCAGCCCATGG + Exonic
1199942294 X:152638184-152638206 CGCCCAGAACGCCCCGGCCATGG + Exonic
1199944873 X:152657293-152657315 CGTCCAGGACATCCAGGTCTTGG - Exonic
1200081188 X:153577270-153577292 CATAAAGGACAGCCAGGCCACGG - Intronic
1200111215 X:153741857-153741879 GTCCCAAGAGAGCCAGGCCACGG + Intronic
1202373773 Y:24215133-24215155 CACCCAGGACACCCAGGAAATGG - Intergenic
1202497008 Y:25454987-25455009 CACCCAGGACACCCAGGAAATGG + Intergenic