ID: 1160679955

View in Genome Browser
Species Human (GRCh38)
Location 19:408017-408039
Sequence CTCGATCTGGATCACGTGCC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 40
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 34}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160679951_1160679955 -8 Left 1160679951 19:408002-408024 CCAGTCCTCGGCACTCTCGATCT 0: 1
1: 0
2: 0
3: 2
4: 47
Right 1160679955 19:408017-408039 CTCGATCTGGATCACGTGCCGGG 0: 1
1: 0
2: 0
3: 5
4: 34
1160679950_1160679955 2 Left 1160679950 19:407992-408014 CCTCGGACAGCCAGTCCTCGGCA 0: 1
1: 0
2: 1
3: 13
4: 82
Right 1160679955 19:408017-408039 CTCGATCTGGATCACGTGCCGGG 0: 1
1: 0
2: 0
3: 5
4: 34
1160679946_1160679955 26 Left 1160679946 19:407968-407990 CCTGGGGGTCGGCGTCAGTGGCC 0: 1
1: 0
2: 1
3: 8
4: 91
Right 1160679955 19:408017-408039 CTCGATCTGGATCACGTGCCGGG 0: 1
1: 0
2: 0
3: 5
4: 34
1160679948_1160679955 5 Left 1160679948 19:407989-408011 CCTCCTCGGACAGCCAGTCCTCG 0: 1
1: 0
2: 1
3: 8
4: 80
Right 1160679955 19:408017-408039 CTCGATCTGGATCACGTGCCGGG 0: 1
1: 0
2: 0
3: 5
4: 34

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160679955 Original CRISPR CTCGATCTGGATCACGTGCC GGG Exonic
1064232090 10:13538046-13538068 GTCGATCTGGTTCACATGCCTGG - Intergenic
1079417632 11:20254304-20254326 CTAGATCTGGAACAGGTGGCAGG + Intergenic
1082058603 11:47841622-47841644 CTCGAACTAGAGCACGTTCCAGG - Intronic
1092720753 12:11438186-11438208 CTTGCTCTGGATCACATGCCTGG - Intronic
1103995577 12:124827879-124827901 GTCCATCTGTATCACCTGCCTGG + Intronic
1119430881 14:74567397-74567419 CTCGCTCTGGCTCTCTTGCCTGG - Intronic
1135475051 16:22766657-22766679 CGAAATCTGGATCACTTGCCAGG + Intergenic
1140189154 16:72800066-72800088 CTCGATCTGGAACAGCTGCTGGG + Exonic
1147857413 17:43492788-43492810 CCCGCTCTCGATCACGTTCCAGG + Exonic
1148786769 17:50149548-50149570 CTCGGCCTGGATCACCTCCCCGG + Exonic
1152403753 17:80084903-80084925 CTCGATCAGGATCGTGCGCCGGG - Exonic
1160679955 19:408017-408039 CTCGATCTGGATCACGTGCCGGG + Exonic
1161473291 19:4472116-4472138 GTCGATCAGGACCACGTGCAGGG - Intergenic
1161699129 19:5785375-5785397 CTGGATCCGCATCAGGTGCCTGG - Exonic
1163012405 19:14433941-14433963 CTCCACCTGGGGCACGTGCCTGG + Intronic
1163506031 19:17706814-17706836 CGGGATCTGGACCACGTGGCTGG + Intergenic
928304734 2:30158777-30158799 CTCGAACTAGAGCACGTTCCAGG - Exonic
932302711 2:70678438-70678460 CTGGTTCTGGGTCATGTGCCTGG + Intronic
942752087 2:179299635-179299657 CTCTATCTGGAACACTTGTCAGG + Intergenic
945303754 2:208238751-208238773 CTCGATTTGGTTCATGTGCTGGG - Intronic
948801950 2:240437038-240437060 CTCGGTCTGTACCGCGTGCCAGG + Intronic
949059198 2:241947018-241947040 CCCGAGCTGGATCACGTGCTGGG + Intergenic
1181291680 22:21799092-21799114 CTGGATCTGCAACACGGGCCAGG + Exonic
1183222852 22:36528362-36528384 CTCGACCTGCATCACCTCCCTGG + Intronic
953885029 3:46710223-46710245 CTTGAGCTGGATCCCCTGCCAGG - Exonic
955689014 3:61572418-61572440 CTCGTTCTGGATCTTGTGTCTGG + Intronic
955751350 3:62187904-62187926 CTCTAACAGGATCACCTGCCAGG - Intronic
967858520 3:194135114-194135136 CTGGAGCCGGAGCACGTGCCAGG - Intergenic
969176824 4:5405188-5405210 CTCTATCTGGGTCCCGTGCTAGG - Intronic
969704339 4:8783881-8783903 CTCGGTCTGGCTCACGTGCGAGG - Intergenic
984857065 4:184204488-184204510 CTGGTTCTGAATCATGTGCCTGG + Intronic
996411298 5:123162180-123162202 CTCGATCTGGATCTCTGGCGTGG + Intronic
1005077097 6:21919120-21919142 CCTGTTCTGGATCATGTGCCAGG - Intergenic
1006122770 6:31817159-31817181 CTCGATCTGGGGCACGCCCCTGG - Exonic
1006124633 6:31829353-31829375 CTCGATCTGGGGCACGCCCCTGG - Exonic
1017158335 6:151341967-151341989 CTCGTTCTGGGTCCCGTGACAGG + Intronic
1033275895 7:139971424-139971446 ATCGATCTGGATCAGGTGGCAGG + Intronic
1037949855 8:23011864-23011886 CCCGATCTTGATCATCTGCCTGG - Intronic
1049319124 8:141986685-141986707 CTCAAGCTGGACCACGTGTCAGG + Intergenic
1198213606 X:134536993-134537015 CCTGACCTGGGTCACGTGCCTGG + Intergenic