ID: 1160680076

View in Genome Browser
Species Human (GRCh38)
Location 19:408429-408451
Sequence AGTGGGGGGCGGCTGGCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 406
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 372}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160680061_1160680076 24 Left 1160680061 19:408382-408404 CCGGACAGGGGCTGCAGCGTCTG 0: 1
1: 0
2: 0
3: 16
4: 216
Right 1160680076 19:408429-408451 AGTGGGGGGCGGCTGGCAGAGGG 0: 1
1: 0
2: 1
3: 32
4: 372
1160680060_1160680076 25 Left 1160680060 19:408381-408403 CCCGGACAGGGGCTGCAGCGTCT 0: 1
1: 0
2: 2
3: 25
4: 265
Right 1160680076 19:408429-408451 AGTGGGGGGCGGCTGGCAGAGGG 0: 1
1: 0
2: 1
3: 32
4: 372

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160680076 Original CRISPR AGTGGGGGGCGGCTGGCAGA GGG Intronic