ID: 1160680076 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 19:408429-408451 |
Sequence | AGTGGGGGGCGGCTGGCAGA GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 406 | |||
Summary | {0: 1, 1: 0, 2: 1, 3: 32, 4: 372} |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1160680061_1160680076 | 24 | Left | 1160680061 | 19:408382-408404 | CCGGACAGGGGCTGCAGCGTCTG | 0: 1 1: 0 2: 0 3: 16 4: 216 |
||
Right | 1160680076 | 19:408429-408451 | AGTGGGGGGCGGCTGGCAGAGGG | 0: 1 1: 0 2: 1 3: 32 4: 372 |
||||
1160680060_1160680076 | 25 | Left | 1160680060 | 19:408381-408403 | CCCGGACAGGGGCTGCAGCGTCT | 0: 1 1: 0 2: 2 3: 25 4: 265 |
||
Right | 1160680076 | 19:408429-408451 | AGTGGGGGGCGGCTGGCAGAGGG | 0: 1 1: 0 2: 1 3: 32 4: 372 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1160680076 | Original CRISPR | AGTGGGGGGCGGCTGGCAGA GGG | Intronic | ||