ID: 1160680090

View in Genome Browser
Species Human (GRCh38)
Location 19:408476-408498
Sequence GCCTCCCGGCAGGGCCCTGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 454
Summary {0: 1, 1: 0, 2: 3, 3: 43, 4: 407}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160680079_1160680090 1 Left 1160680079 19:408452-408474 CCCTGGGCACCTGCTCCCTGTGG 0: 1
1: 0
2: 9
3: 59
4: 404
Right 1160680090 19:408476-408498 GCCTCCCGGCAGGGCCCTGCCGG 0: 1
1: 0
2: 3
3: 43
4: 407
1160680084_1160680090 -8 Left 1160680084 19:408461-408483 CCTGCTCCCTGTGGGGCCTCCCG 0: 1
1: 0
2: 0
3: 12
4: 290
Right 1160680090 19:408476-408498 GCCTCCCGGCAGGGCCCTGCCGG 0: 1
1: 0
2: 3
3: 43
4: 407
1160680081_1160680090 0 Left 1160680081 19:408453-408475 CCTGGGCACCTGCTCCCTGTGGG 0: 1
1: 1
2: 5
3: 42
4: 419
Right 1160680090 19:408476-408498 GCCTCCCGGCAGGGCCCTGCCGG 0: 1
1: 0
2: 3
3: 43
4: 407

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160680090 Original CRISPR GCCTCCCGGCAGGGCCCTGC CGG Intronic
900119112 1:1041053-1041075 TCCTCCCCGCCGGGCCCCGCAGG - Intronic
900198628 1:1391373-1391395 GCCTGCCGCCAGCGCCCTGGAGG - Intronic
900289081 1:1916232-1916254 GCTGCCTGGCAGAGCCCTGCTGG + Intronic
900604356 1:3517168-3517190 CCCTCCTGGCAGGGCCAGGCAGG + Intronic
900624304 1:3601067-3601089 GCCTCCTGGCAGGGCACTGGGGG - Intronic
900710227 1:4108839-4108861 GCCTCACCTCAGGGGCCTGCTGG + Intergenic
900718444 1:4159903-4159925 GAGTCCCGGCAGGGCTCTCCAGG - Intergenic
901636558 1:10673097-10673119 GCCCCTCCGCAGGGCCCTCCCGG - Intronic
901681578 1:10915900-10915922 GCCTTCAGGCAGGGGCCTTCAGG - Intergenic
902184767 1:14717008-14717030 GCCTCCCAGCTGGGCCTTGAAGG - Intronic
902394471 1:16125138-16125160 GCCTCCCTGCTGTGCCATGCTGG - Exonic
902608067 1:17580279-17580301 GACACCCAGCAGGTCCCTGCAGG + Intronic
902796455 1:18803842-18803864 GATTCCAGGCAGGGCCCTCCTGG + Intergenic
902813839 1:18904803-18904825 CCCTCCCCCCAGGGCCCTGGGGG + Exonic
903189495 1:21648887-21648909 GCTTCCCAGGAGGGCTCTGCGGG + Intronic
903261450 1:22133794-22133816 GCCTCCTGGGAGGAGCCTGCAGG - Intronic
903548626 1:24142571-24142593 GCCTCCCTCCATGCCCCTGCAGG - Intronic
903724320 1:25430052-25430074 GCCTCCGGGCCGGGCCGGGCCGG - Intronic
903731922 1:25503065-25503087 GCCTCGCAGCAGGGGCCTGCTGG + Intergenic
904303409 1:29570973-29570995 GGCTCCCTGCAGGGCCCAGGTGG - Intergenic
905627377 1:39497925-39497947 TCCTCCAGGCAGGGCCCTGTGGG - Intronic
905669052 1:39779186-39779208 TCCTCCAGGCAGGGCCCTGTGGG + Intronic
907283148 1:53363634-53363656 GCTTCCTGCCAGGGCCCTGTGGG + Intergenic
907671466 1:56477908-56477930 CCCTCCCCGCGGGGCTCTGCCGG - Intergenic
910163432 1:84298542-84298564 ACCTCCCGGCGCGGCCATGCGGG + Exonic
912945339 1:114079735-114079757 GCCTTCCAGAAGAGCCCTGCAGG - Intergenic
914224281 1:145707549-145707571 GCCTCCCCGCAGGGCCAGGCAGG - Intronic
914490071 1:148146324-148146346 GCCGCCCGGCCTGGCCCGGCAGG - Intronic
914827644 1:151146815-151146837 GCCTCCCGGCCTGGCCCTCTGGG - Intergenic
915143972 1:153783737-153783759 TCCGCCCGGCGGGCCCCTGCAGG + Intergenic
915255809 1:154627731-154627753 GCGCCCCGGCAGGGCACTGAGGG - Intronic
918765701 1:188480211-188480233 GCCTGCCTGCACTGCCCTGCTGG - Intergenic
919919704 1:202160731-202160753 GCCTCCCGCCTGTGCCCTTCTGG + Exonic
921390463 1:214608889-214608911 GCCGCCCGGCCTGGCCCGGCAGG + Intronic
922452941 1:225751226-225751248 GACACCCAGCAGGGCTCTGCAGG + Intergenic
922575434 1:226658283-226658305 TCCCCCTGGCAGGGCCCAGCTGG + Intronic
922669061 1:227495039-227495061 GCCACCCGGCAGGCCCGCGCTGG + Intergenic
922670536 1:227506263-227506285 GCCACCCGGCAGGCCCGCGCTGG - Intergenic
923207913 1:231776501-231776523 GCCTCGCGGCAGGGCTGGGCTGG + Intronic
923611984 1:235504140-235504162 GCCTCCGGGGCCGGCCCTGCAGG - Exonic
924223556 1:241902604-241902626 GCCTCCCTTCAGGCTCCTGCAGG + Intergenic
924242843 1:242057169-242057191 GCCACCCGGCAGGTCCGCGCTGG - Intergenic
1063184326 10:3636899-3636921 GGCTCCCAGCAGTGCGCTGCCGG - Intergenic
1063422643 10:5925590-5925612 GCCTCCTGGTAGGGCACTTCTGG + Intronic
1064430053 10:15262957-15262979 TCCTCCCAGGAGGGCCCTGGTGG - Intronic
1065240034 10:23695393-23695415 CCCTCCCGGCCTGGCCCTCCTGG - Intronic
1065916288 10:30357085-30357107 GCCACCCCGTCGGGCCCTGCTGG - Intronic
1067234808 10:44438584-44438606 GCCTGACGTCAGCGCCCTGCAGG + Intergenic
1067442077 10:46314227-46314249 GACACCTGGCAGGGCACTGCTGG + Intronic
1067682246 10:48448532-48448554 GCCCCTCCCCAGGGCCCTGCTGG - Intronic
1067713720 10:48671333-48671355 GCCCTCAGGCAGGGCCCTGGCGG + Intergenic
1067726522 10:48774974-48774996 CCCTCCCGGCAGAGCCTTCCAGG - Intronic
1067853143 10:49768380-49768402 GCTTCCCGCCGGGGCCCTGAGGG - Intergenic
1069535253 10:69248318-69248340 CCCGCCCCGCAGGGCCCTCCGGG + Intronic
1070152076 10:73811365-73811387 GCCGCCCGGGACGACCCTGCGGG + Intronic
1070808776 10:79286836-79286858 GGCCACAGGCAGGGCCCTGCCGG + Intronic
1072798772 10:98377243-98377265 GACTCCAGGCTTGGCCCTGCTGG + Intergenic
1073062739 10:100742078-100742100 GCCCCGGGTCAGGGCCCTGCAGG + Intronic
1073544159 10:104335106-104335128 GCCTCCTGGGAGGGGCCAGCTGG - Intronic
1076326688 10:129629085-129629107 GCCGCCTGGCAGGGCGCTGGTGG - Intronic
1076745482 10:132510606-132510628 GCCTCCCCACAGGGCCCTGCCGG + Intergenic
1076837332 10:133027719-133027741 GCCTCCCTGCAAGGCCCTCACGG - Intergenic
1077328751 11:1974805-1974827 GCCTCCCCACAGGCCCCCGCTGG - Intronic
1077403078 11:2368560-2368582 GCCTCCCGGGTGGGCCCAGGAGG - Intergenic
1077480548 11:2812504-2812526 GCCTCCCGGAAATGCCCTTCCGG - Intronic
1077501091 11:2910011-2910033 GCCTCCCAGCAGCCTCCTGCTGG + Intronic
1078579126 11:12525345-12525367 GCCTCCAGGCATGGCTGTGCAGG - Intronic
1078823832 11:14907581-14907603 GCCTCCAGGCAGCGCCATTCAGG + Intronic
1078934858 11:15941503-15941525 GCCTCCCCGGAGGGCCCTCACGG + Intergenic
1079115971 11:17640834-17640856 GCCTCGGGGCAGAGCCATGCAGG + Intronic
1079126491 11:17721452-17721474 GCCGCCCCGCAGTGCCCTGCGGG + Exonic
1080422834 11:32126898-32126920 GGCTCCCCACACGGCCCTGCTGG + Intergenic
1080925893 11:36755478-36755500 GCATCCCTGCAGGGTCCTGGGGG + Intergenic
1081656900 11:44863344-44863366 GCCTCCAGGCTTGGCCGTGCTGG + Intronic
1081812560 11:45922144-45922166 GTGGCCCGGCCGGGCCCTGCCGG - Intronic
1083663568 11:64263136-64263158 GCGTCCATGCAGGGCCGTGCGGG - Intronic
1084170862 11:67400448-67400470 GTCACCAGGCAGGGCCCTGGGGG + Intronic
1084413935 11:69019625-69019647 GCTTCCCGCCAGGCCCCTGAGGG - Intergenic
1084496808 11:69509909-69509931 GCCTCCTGGCAGGGGGATGCAGG + Intergenic
1084777074 11:71384373-71384395 GCCTCGCTGCAGGGATCTGCAGG + Intergenic
1084785770 11:71440815-71440837 GCTTCCCAGGAGAGCCCTGCTGG - Intronic
1085734925 11:79030855-79030877 GGCCCCCGCCAAGGCCCTGCTGG + Intronic
1089273426 11:117316392-117316414 CCTTCCCGCCAGGGCCTTGCAGG - Intronic
1089303327 11:117511765-117511787 GCCTTACGGGAGGGCCCTGGTGG + Intronic
1089350976 11:117821606-117821628 GCCACCCGGCACTGCCCTCCGGG + Intronic
1089750828 11:120649987-120650009 GCCACCAGGCTGGGCCCTGGGGG - Intronic
1090411834 11:126514393-126514415 GCCTGCTGGGAGGGGCCTGCAGG + Intronic
1090948222 11:131450077-131450099 GCCTACCTGCAGGGACCTGCAGG - Intronic
1202811730 11_KI270721v1_random:29984-30006 GCCTCCCCACAGGCCCCCGCTGG - Intergenic
1091567649 12:1660988-1661010 GCCTCCTGGCAGCCCCATGCGGG + Intergenic
1092270234 12:7018163-7018185 GCCACCCGGGAGGGCTGTGCCGG - Intronic
1094047118 12:26179300-26179322 GCCTCTCAGCATGGCCCTGCTGG - Intronic
1094814109 12:34166851-34166873 GCCACCCGGCAGGCCCGAGCTGG + Intergenic
1095102788 12:38201648-38201670 GCCACCCGGCAGGCCCGAGCTGG - Intergenic
1096409054 12:51364355-51364377 GCCTCCTGGTTGGGGCCTGCAGG - Exonic
1096498075 12:52050221-52050243 ACAGCCCGCCAGGGCCCTGCTGG - Intronic
1103335214 12:120184210-120184232 GGCTGCCTGCAAGGCCCTGCGGG + Exonic
1103796355 12:123505882-123505904 GCCTGCCATCAGGGCCCTTCGGG - Intronic
1104373900 12:128247470-128247492 GCCTCCCCGCAGGGCAGGGCTGG + Intergenic
1104795197 12:131512270-131512292 CCCTCCCTGCAGAGGCCTGCTGG - Intergenic
1105443794 13:20435849-20435871 GCCTCCCGCGAGGGCGCTGTCGG - Intronic
1105472247 13:20704305-20704327 GCGTCCTGGCGGGGCCCGGCAGG + Intronic
1105801152 13:23903952-23903974 TCCTCACTGCAGGACCCTGCCGG + Intergenic
1105847728 13:24307984-24308006 TCCTCCCGCCAGGACCCTGCCGG - Intronic
1106242057 13:27920424-27920446 CCCTCCGGGAAGGGCCCGGCGGG - Exonic
1106482944 13:30150301-30150323 CCCAGCAGGCAGGGCCCTGCTGG + Intergenic
1110241134 13:73268473-73268495 TCCTCCCAGCATGGCTCTGCAGG + Intergenic
1110805121 13:79745364-79745386 GCATCCTGGCAGGGCCAGGCTGG - Intergenic
1113437980 13:110307679-110307701 GCCTCCCGTTAGGCCCCTGTGGG - Intronic
1113715291 13:112501392-112501414 GCTGCCAGGCAGGGCTCTGCTGG + Intronic
1114455821 14:22852970-22852992 GCCTCCTGGCTGGGCCCTCCAGG - Intergenic
1114494145 14:23121033-23121055 GGCTCTCGGCAGGCTCCTGCGGG + Intergenic
1114614062 14:24059123-24059145 GCCTCCCTGCAGGACCCTGGAGG + Exonic
1119475202 14:74923008-74923030 CCCGCCGGGCAGGGTCCTGCCGG + Intronic
1120215716 14:81679326-81679348 GCCTCCCCGCAGGGCAGGGCTGG - Intergenic
1121329293 14:93040004-93040026 GCCTCCCAGCAGGGGCTGGCAGG - Intronic
1122231063 14:100306499-100306521 GCCTGCCGGCAGGGCCCGGGTGG + Exonic
1122275227 14:100587488-100587510 TCCTCCCGGCAGCGCCCGGCCGG + Intergenic
1122275232 14:100587493-100587515 GCGCCCCGGCCGGGCGCTGCCGG - Intergenic
1122715352 14:103693678-103693700 GCCTCCGGGCAGGGCGGTGAGGG - Intergenic
1122838600 14:104443486-104443508 CCCACCCAGCAGGGCTCTGCAGG + Intergenic
1123158825 14:106257703-106257725 ACCTCCCTGCAGGGCCGCGCGGG - Intergenic
1123162152 14:106288967-106288989 ACCTCCCTGCAGGGCCATGCGGG - Intergenic
1202859449 14_GL000225v1_random:72379-72401 TCCTCCGCGCAGGGCCCGGCAGG + Intergenic
1123401096 15:19987597-19987619 ACCTCCCTGCAGGGGCGTGCGGG - Intergenic
1123630720 15:22258151-22258173 GGCTCCCGTCAGGGGCCGGCGGG - Intergenic
1124348055 15:28935442-28935464 GCCTCCAGGCAGTGAGCTGCTGG + Intronic
1127585941 15:60378011-60378033 GCCTCCTGGCAGAACCCTCCTGG - Intronic
1129231523 15:74199623-74199645 TCCCCCAGGCAGGGCCCTGGAGG - Intronic
1129403895 15:75301790-75301812 GCCACCCTGCCAGGCCCTGCTGG + Intergenic
1130983118 15:88826509-88826531 TCCACAGGGCAGGGCCCTGCTGG - Intronic
1131098859 15:89672701-89672723 GCCTCCAGCCAGGGCCCTAGAGG - Intronic
1131461166 15:92618424-92618446 GCCTTCCGGCAGGGACCTCCTGG + Exonic
1132204093 15:99974705-99974727 GCCTCCTGCCAGGGCACTGGGGG + Intronic
1132322107 15:100933085-100933107 GCCTCCTGGGAGGCTCCTGCAGG + Intronic
1132502038 16:288745-288767 GGCTGCACGCAGGGCCCTGCAGG + Intronic
1132508042 16:322287-322309 GGCTCCAGGGATGGCCCTGCTGG + Intronic
1132573894 16:656073-656095 GCCTCACGGAAGGGCCCGGTGGG + Intronic
1132581826 16:688257-688279 ACCTTCCTCCAGGGCCCTGCAGG + Intronic
1132829228 16:1919326-1919348 GCCTCTCGGGTGGGACCTGCGGG + Intergenic
1132982402 16:2745232-2745254 CCCTCCAGGCAGGTACCTGCAGG - Intergenic
1133057132 16:3150948-3150970 GCAGTCCGCCAGGGCCCTGCCGG - Intergenic
1133236239 16:4388659-4388681 GCCCACCAGCAGGGCCCTGGGGG - Intronic
1134522608 16:14925478-14925500 GCCTCCTGTCAGGGTCCAGCTGG + Intronic
1134550021 16:15134578-15134600 GCCTCCTGTCAGGGTCCAGCTGG - Intronic
1134674939 16:16083646-16083668 GCCGCCCAGCTGAGCCCTGCCGG - Intronic
1134710276 16:16324129-16324151 GCCTCCTGCCAGGGTCCAGCTGG + Intergenic
1134718448 16:16368417-16368439 GCCTCCTGCCAGGGTCCAGCTGG + Intergenic
1134949327 16:18344516-18344538 GCCTCCTGCCAGGGTCCAGCTGG - Intergenic
1134956306 16:18383742-18383764 GCCTCCTGCCAGGGTCCAGCTGG - Intergenic
1135091508 16:19521793-19521815 GCCCTCTTGCAGGGCCCTGCAGG - Exonic
1135992469 16:27226534-27226556 GCCTCCCTGCTGTGCCCCGCAGG - Intronic
1136011156 16:27364071-27364093 GCCCCACGGCAGGCCCCTGCAGG + Exonic
1136040058 16:27571649-27571671 GGGGCCCTGCAGGGCCCTGCTGG + Intronic
1136285902 16:29241642-29241664 GCATCAGGGCAGGGCCCAGCTGG - Intergenic
1137328043 16:47461262-47461284 GCCTCCCGACAGTGTCGTGCGGG + Exonic
1137459689 16:48649381-48649403 GCCTGCCAGGAGGGGCCTGCAGG + Intergenic
1139965503 16:70742780-70742802 GCCTCCCGCCACAGCCCAGCCGG - Intronic
1140478791 16:75251636-75251658 GCCTGCCGCCACGGCCCAGCCGG + Intronic
1140892720 16:79298782-79298804 GACACCCAGCAGGGCCTTGCAGG + Intergenic
1141940002 16:87269256-87269278 GCTGCCAGGCAGGGCCATGCAGG - Intronic
1141972331 16:87492428-87492450 GGCTCCCGTCAGGGGCCGGCGGG + Intergenic
1142091241 16:88211828-88211850 GCATCAGGGCAGGGCCCAGCTGG - Intergenic
1142192079 16:88722684-88722706 GCCGCCCTGCAGGGCACAGCAGG + Exonic
1142440338 16:90094104-90094126 GCCACCCGGCAGGCCCGGGCTGG - Intergenic
1142668282 17:1474893-1474915 GCCTCCCCGCAGGCCCCTGTGGG + Intronic
1143371876 17:6445295-6445317 ACCTCCGCGCAGGGCCCTCCTGG + Exonic
1143479466 17:7220152-7220174 GCCGCCGGGCAGGGCCGGGCCGG - Exonic
1143498068 17:7323713-7323735 GTCTCCTGGCAGGGCCCTGCGGG - Exonic
1144578917 17:16447021-16447043 TCATCCCTGCAGGTCCCTGCAGG - Intronic
1144653813 17:17022730-17022752 GCCTCTGGGCCAGGCCCTGCTGG + Intergenic
1144778945 17:17798382-17798404 GCCTCCCCGCCGGGCTCTGCCGG - Exonic
1145190674 17:20840976-20840998 GCCGCCCGGCCTGGCCCGGCAGG - Intronic
1145265392 17:21377375-21377397 GCCTCCCGTCAGAGACCTGCGGG + Intronic
1145268749 17:21393083-21393105 GCCTCCCTGCACGGCCGTACCGG + Intronic
1146266831 17:31458387-31458409 GCCTCCCCGCAATGCCCTGCGGG - Intronic
1146529619 17:33597249-33597271 CCTTCCCTGCAGGGCCCTGTGGG - Intronic
1146559821 17:33858366-33858388 GCCACCAGGCTGGACCCTGCAGG - Intronic
1146654481 17:34626896-34626918 GCCCCCCAGGAGGACCCTGCAGG + Exonic
1147192047 17:38743701-38743723 ACCTGCTGGCAGGGCCCTGCAGG - Intronic
1147951378 17:44109854-44109876 TCCTCCAGGGAGGGGCCTGCTGG - Intronic
1148124354 17:45229240-45229262 GCTTTCCGGCCAGGCCCTGCTGG - Intronic
1148795034 17:50192840-50192862 CTCTCCCTGCAGGGTCCTGCTGG - Exonic
1149004393 17:51789962-51789984 GACTCCCGGGAGGGCCCTTAGGG - Intronic
1149641599 17:58206370-58206392 GCCTCCCTGCAGGGCCTTCATGG - Exonic
1149655749 17:58308846-58308868 ACCTCCGGGAAGGGCCCAGCCGG + Exonic
1152076221 17:78161468-78161490 GTCTCCTGGCAGGGGCCTGAGGG + Intronic
1152209563 17:78995887-78995909 GCTTCTCTGCAGGGCCCTGGAGG + Intronic
1152363901 17:79844438-79844460 GGCGGCCGGCAGGGCCCAGCCGG + Intergenic
1152363902 17:79844443-79844465 GCGGTCCGGCTGGGCCCTGCCGG - Intergenic
1152540433 17:80971859-80971881 TCCTCCCTGGAGGGCCCTGGGGG - Intergenic
1152588686 17:81200485-81200507 GCGCCCCGGCAGGACCCAGCTGG + Intronic
1152793145 17:82292984-82293006 GTCTCCTGGCCGGGCCCTCCTGG - Intergenic
1152884332 17:82840585-82840607 GCCTGGCTGCAGGGACCTGCCGG + Intronic
1152925852 17:83087452-83087474 GCCTCTCGTGAGGGCCCTGGAGG - Intronic
1152957220 18:49454-49476 GCCACCCGGCAGGCCCGGGCTGG + Intronic
1154502490 18:15003719-15003741 GTCCCCGGGCTGGGCCCTGCAGG - Intergenic
1155036144 18:22026519-22026541 GCCTTCAAGCAGGGCCCGGCTGG - Intergenic
1156441761 18:37197140-37197162 GCATCCCAGCAGGGCTCTGGGGG - Intronic
1156463353 18:37333930-37333952 CCCTCCCAGCAAGGCCCTTCTGG - Intronic
1156485625 18:37463885-37463907 ACCTCCTGGCAGGGCCATCCAGG + Intronic
1157293776 18:46427489-46427511 CCCTCCCGGGTGGGCCCTGGTGG - Intronic
1157692125 18:49692152-49692174 GCATCCTGGCTGGGCCCTGAAGG + Intergenic
1158634952 18:59148239-59148261 GCCTCCCTGGAGGGCGGTGCTGG + Intronic
1160006461 18:75072624-75072646 CGCTCACGGCAGGGCCGTGCAGG + Intergenic
1160605441 18:80046440-80046462 GGCACCTGGCAGGGCTCTGCAGG - Intronic
1160680090 19:408476-408498 GCCTCCCGGCAGGGCCCTGCCGG + Intronic
1160680095 19:408481-408503 CCCCGCCGGCAGGGCCCTGCCGG - Intronic
1160810348 19:1010487-1010509 GGCCCCCAGCAGGGCCCAGCGGG + Exonic
1160810353 19:1010492-1010514 GCCAGCCCGCTGGGCCCTGCTGG - Exonic
1160837978 19:1133386-1133408 GACTCCCGCCAGGGCTCTGAGGG + Intronic
1160995833 19:1881615-1881637 GCCGCCCGGCCTGGCCCGGCAGG + Exonic
1160995915 19:1881851-1881873 GCCTCCCGGGGGTGCCCAGCTGG - Intronic
1161203664 19:3029266-3029288 GGCTCCCGGCCGAGCCCCGCCGG - Intronic
1161672683 19:5622956-5622978 GCGTCCCGGCAGTTCCCGGCGGG + Exonic
1161703235 19:5805859-5805881 GCCCCCCGCCCGGGCTCTGCAGG - Intergenic
1161722383 19:5910278-5910300 GCCTCCTGGTAGGGTCCTGCTGG + Exonic
1161751380 19:6099812-6099834 GCCTCCCAGCTGGGGGCTGCTGG - Intronic
1162140177 19:8580732-8580754 CCCCCCAGCCAGGGCCCTGCAGG + Exonic
1162421637 19:10568890-10568912 GGCGCCGGGCAGGGCCCCGCGGG - Exonic
1162895534 19:13762964-13762986 GCCTCCTGGGAGGAGCCTGCTGG - Exonic
1163145981 19:15379582-15379604 GCCTCTCCGGAGGGCCCAGCTGG + Intronic
1163441374 19:17324056-17324078 GCCTCTGGGCACGGCCCTGCCGG + Intronic
1163731748 19:18953628-18953650 ACCACCTGGAAGGGCCCTGCAGG - Intergenic
1164157340 19:22604653-22604675 GCCTTCCGGCTGGGCCCTCAGGG - Intergenic
1165015077 19:32874884-32874906 GCAGCCCAGCGGGGCCCTGCAGG + Intergenic
1165081862 19:33311499-33311521 CCCTCCTGGCAGTGCCCTACAGG - Intergenic
1165828693 19:38719913-38719935 GTCTCCGGCCAGGGCCCAGCTGG + Intronic
1166268600 19:41700236-41700258 GCCTCCAGGGAGGGGGCTGCAGG + Intronic
1166794910 19:45420209-45420231 GCCTCTGGGCATGGTCCTGCAGG - Intronic
1167001128 19:46746297-46746319 GCCCCCGGGCCGGGCCCGGCAGG - Exonic
1167011723 19:46813189-46813211 GCCTCCCAGGAGGGGCCTGGAGG + Intergenic
1167268179 19:48493610-48493632 GCCTCCCGCCAGGCCCTTCCCGG + Intronic
1167271049 19:48506505-48506527 GCCTCCCGCCAGGCCCCAGTAGG - Intronic
1168133843 19:54337646-54337668 GGGTCACGACAGGGCCCTGCAGG + Exonic
1168350128 19:55670866-55670888 GCTTCCCTGCTGAGCCCTGCAGG + Intronic
1168352007 19:55681180-55681202 GCCTCCCTGCATGGCCTTGGGGG + Intronic
926268079 2:11344339-11344361 CGCTCCCGGCAGGGCCGGGCCGG - Exonic
926914019 2:17876646-17876668 GGCTCCCTGCAGGGCTCAGCAGG + Intergenic
927667477 2:25042396-25042418 GCCCCGCGCCAGGGCCGTGCAGG - Intronic
927670216 2:25062724-25062746 GCCTCCCCCCACTGCCCTGCCGG - Intronic
927964660 2:27261801-27261823 GCGTCTCTGCAGGCCCCTGCAGG + Intronic
927965519 2:27265224-27265246 GGCTCCCGGCAGGGGCGGGCAGG - Intronic
929546856 2:42861538-42861560 GCCTCCTGGGATGTCCCTGCAGG + Intergenic
929591871 2:43152976-43152998 GCCTCTAGGGAGGGCCCGGCTGG - Intergenic
929947254 2:46380742-46380764 GCCTCTCGGTTCGGCCCTGCTGG - Intronic
930025573 2:47027263-47027285 GGCGCACGGCAGGGCCCAGCTGG - Intronic
933791538 2:85887848-85887870 TCCTCGTGGCAGGGCCGTGCTGG - Intronic
934026195 2:88003310-88003332 GCCCCGCGGCAGCGCCCAGCAGG - Intergenic
934163535 2:89274105-89274127 GCTTCCCAGCAGAGTCCTGCTGG + Intergenic
934203738 2:89908419-89908441 GCTTCCCAGCAGAGTCCTGCTGG - Intergenic
934219888 2:90072915-90072937 GCTTCCCAGCAGAGTCCTGCTGG - Intergenic
936009859 2:108918635-108918657 GACTCCGGGGAGGGTCCTGCCGG + Intronic
936021804 2:109000929-109000951 GCCTCAGGGCAGGGCACTGAAGG - Intergenic
937250273 2:120519435-120519457 GCCGCCTGTCAGGACCCTGCTGG + Intergenic
937263629 2:120602022-120602044 GCCTCCCTGCAGGCTCCTGAGGG + Intergenic
937292655 2:120790870-120790892 ACCTGCCTGCAGGGCCCTGGGGG - Intronic
937325050 2:120985340-120985362 GGCACACGGCAGGGCACTGCAGG + Intronic
937361316 2:121231851-121231873 GTCTACCGGCAGGGCCCCACGGG - Exonic
938080922 2:128369744-128369766 GCCTGCCGGCAGGGCCTGGGAGG + Intergenic
945069654 2:205977411-205977433 GCCTCCCTGCAGGGCAGGGCTGG + Intergenic
946354525 2:219176710-219176732 GCCTCCCGGCGCGCCCCTCCCGG - Intronic
947638590 2:231693455-231693477 GCCTCAGGCCAGGGCCTTGCTGG - Intergenic
947860684 2:233355038-233355060 GGCTCCCGGCTGCGCCCCGCGGG + Intronic
948055779 2:235008351-235008373 GCCTCCCTGCAGGGCCCAGGAGG + Intronic
948205287 2:236160035-236160057 GCCTCCAGGCCTGGTCCTGCAGG - Intergenic
948209233 2:236179773-236179795 CCGTCCCGGCCGGGCGCTGCGGG + Intergenic
948264699 2:236628110-236628132 TCCTCCAGGCAGTGACCTGCAGG + Intergenic
948606187 2:239137214-239137236 GCCTCGGGGCCGAGCCCTGCGGG + Intronic
948653083 2:239461213-239461235 GCCTTCCCACAGGCCCCTGCTGG + Intergenic
948921192 2:241066676-241066698 GCCGCCCCGCAGGGCCCTGCTGG - Intronic
949027949 2:241775074-241775096 GGCTCCCAGCAGGGCCCCACTGG + Intergenic
1169813685 20:9634267-9634289 GCCTCTTGGCAGGGCCATCCTGG - Intronic
1171977381 20:31604234-31604256 GCCTCCCGCCCGGGGTCTGCAGG + Intergenic
1172614675 20:36275325-36275347 GCCTCCCTGCTGGCCCCTGGTGG - Intergenic
1173335222 20:42107002-42107024 GCCTCCCAGCAGGACCCTTGGGG - Intronic
1174929067 20:54793792-54793814 GTCACCCGGCAGGGCCCCCCTGG - Intergenic
1175186670 20:57183658-57183680 GGGTCCCGCCGGGGCCCTGCTGG + Intronic
1175304955 20:57969503-57969525 GCATCCCTGCAGGGCACAGCAGG - Intergenic
1175419250 20:58821056-58821078 GCTTCTGAGCAGGGCCCTGCTGG - Intergenic
1176052012 20:63124839-63124861 TCCTCCTGGCAGGGCCCCTCAGG - Intergenic
1176156753 20:63626262-63626284 GCCTGCCGGGTGGCCCCTGCGGG + Intronic
1176410843 21:6448648-6448670 GCCTCCCGGGTGGGCTTTGCAGG - Intergenic
1176722248 21:10402214-10402236 ACCGGCAGGCAGGGCCCTGCAGG - Intergenic
1179012736 21:37568633-37568655 GCCTCCCAGCAGGGCCTCGAGGG + Intergenic
1179686336 21:43056970-43056992 GCCTCCCGGGTGGGCTTTGCAGG - Intronic
1180102720 21:45596849-45596871 GTGTCCCCGGAGGGCCCTGCAGG + Intergenic
1180303433 22:11054976-11054998 ACCGGCAGGCAGGGCCCTGCAGG - Intergenic
1180611010 22:17097952-17097974 GCATGCCAGCAGGGCCCTGGGGG + Intronic
1181002277 22:19993484-19993506 GCCTTCCCCCAGGGCCCTCCTGG - Intronic
1181440715 22:22934008-22934030 GGCCCAAGGCAGGGCCCTGCAGG + Intergenic
1181568618 22:23754236-23754258 GCCTCCTTGCAGGGGCCTTCTGG + Intronic
1181728135 22:24825747-24825769 GCCACCCTGCAGGGCCCTCCAGG + Intronic
1182075857 22:27495043-27495065 GTCTCCTGGCAGGGCCCAGGGGG - Intergenic
1182837056 22:33350690-33350712 GCCTCACGGAAGGTGCCTGCTGG - Intronic
1183672731 22:39282748-39282770 TCCTCTTGGCAGGGCCCTGCAGG + Intergenic
1184210962 22:43035393-43035415 ACCAGCAGGCAGGGCCCTGCAGG + Intergenic
1184564681 22:45285016-45285038 GCCTCCGCTCTGGGCCCTGCTGG + Exonic
1184732315 22:46377696-46377718 GTCTCCAGGCTGGGTCCTGCTGG + Intronic
1185055343 22:48576082-48576104 GCCCGCCGTCCGGGCCCTGCTGG + Intronic
1185117204 22:48944673-48944695 CCCTCCAGCCAGGGCCCAGCTGG - Intergenic
1185331142 22:50252537-50252559 CCCTCCCCCCAGGGACCTGCTGG + Intronic
1185420338 22:50731334-50731356 CCCTGCCGGCAGGGCACGGCCGG - Intergenic
949663067 3:6303969-6303991 GCCCCCCGGCAGGGCTGAGCAGG + Intergenic
950377407 3:12582987-12583009 GCCTCCAGCCAGGGCCCTCTAGG + Exonic
950451509 3:13068128-13068150 GCCCCGGGGCAGGACCCTGCTGG - Intronic
950541608 3:13616516-13616538 GCCTCCAGGCAGGGCCATGATGG - Intronic
953423037 3:42769895-42769917 GCCTCCCCGCAGGGCAGGGCTGG + Intronic
954110181 3:48429251-48429273 ACCACCCGGCCGGGCCCCGCGGG + Exonic
954410101 3:50366780-50366802 GACTCCAGGAAGGGCACTGCTGG + Intronic
954784661 3:53084089-53084111 TTCTCCCTGCATGGCCCTGCCGG + Intronic
959893533 3:111582818-111582840 GCCTCCCACCAGGTCCCTTCTGG + Intronic
960101257 3:113745909-113745931 GCAGCCGGGCAGGGCCCGGCCGG - Intronic
961369759 3:126422246-126422268 GGCTGCCTGCAGGGCGCTGCTGG - Intronic
961446505 3:126983822-126983844 GCCTCCCAGCAGGGCCGCGGGGG + Intergenic
962351494 3:134659795-134659817 TCCTCCCGCCAGGCCCCTGGGGG - Intronic
963239657 3:142990724-142990746 GCCTCCCACCAGGTCCCTCCGGG - Intronic
963770140 3:149380242-149380264 CCCGCCCCGCAGCGCCCTGCCGG + Intergenic
963770144 3:149380247-149380269 CACTCCCGGCAGGGCGCTGCGGG - Intergenic
963851014 3:150210648-150210670 GCTTCCCTGCAGGGGCCTGTAGG + Intergenic
966933694 3:184691895-184691917 GCCCCCTGACAGGGCCCTCCCGG - Intergenic
967859786 3:194141850-194141872 GCCGCCTGGCAGGGCTCTGCGGG - Intergenic
967916738 3:194583993-194584015 TCTTCCCGGAAGTGCCCTGCTGG + Intergenic
968293160 3:197554773-197554795 GCCTCCAGGCTGCGCCCTTCTGG - Intronic
968457663 4:707202-707224 GCCACCTGGCAGGGCCCGGGGGG + Intronic
968469693 4:773751-773773 GCCTCCCTGCAGGGCAGGGCAGG + Intergenic
968473360 4:791865-791887 GCTTCCAGCCAGGGCCGTGCTGG + Intronic
968509756 4:990385-990407 GGCTCCCGCCAGGCGCCTGCTGG - Intronic
969271802 4:6108143-6108165 GCCTGGGGACAGGGCCCTGCTGG + Intronic
969425606 4:7122157-7122179 GCCTCCCAGCAGGGACCAGGCGG - Intergenic
972631193 4:40843277-40843299 CCATCCCTGCAGGGCCCTGCTGG - Intronic
973795814 4:54425196-54425218 GCCCCCTGCCAGGTCCCTGCAGG - Intergenic
974485104 4:62494416-62494438 GCTTCAGGGCAGGGCCCTGATGG + Intergenic
976218784 4:82739485-82739507 GCCTCCCCGCACTGCCCTGGAGG + Intronic
977702247 4:100033938-100033960 GCCTCCCAGCAGGACCATCCTGG + Intergenic
978159351 4:105527191-105527213 GCCTCCAGGCAGGCCCCTCCTGG - Intergenic
978254862 4:106681586-106681608 GCCTCCCCGCAGGGCAGGGCTGG - Intergenic
979624157 4:122827148-122827170 GGATCCCGGCCGGGCCCCGCAGG + Exonic
983212963 4:164977481-164977503 GCCTCCTGGCGAGGCCCTTCTGG + Intronic
985441494 4:189984768-189984790 GCCACCCGGCAGGCCCGGGCTGG + Intergenic
985680191 5:1252080-1252102 GCCTTCCAGCAGGTCCCTGGTGG - Intergenic
985757010 5:1725213-1725235 CCCTCCCGGCAGGCCCGGGCGGG + Intergenic
985824733 5:2183820-2183842 GCCTCCCCGCAGGCCCATCCAGG - Intergenic
987027862 5:13945888-13945910 GCCACCAGGCCAGGCCCTGCAGG + Intergenic
998008861 5:138676939-138676961 GCCTTCAGGCAGGCCCCTCCTGG + Intronic
998151940 5:139762738-139762760 CCCTCCCGGCAGACCCCTCCCGG + Intergenic
1001082963 5:168680437-168680459 GGTTCCCAGCAGGGACCTGCAGG - Intronic
1001549853 5:172594981-172595003 GCCCCCGGGCTGGGCACTGCGGG + Intergenic
1001555409 5:172633695-172633717 GCCTCCTGGCTGGGCACAGCAGG - Intergenic
1001957756 5:175859919-175859941 GCCACCTGGAAGGGACCTGCTGG - Intronic
1002314036 5:178331867-178331889 TCCTCCTGGCCTGGCCCTGCCGG - Intronic
1002324761 5:178397099-178397121 GCCTCCAGGAAGGGCTGTGCTGG + Intronic
1002538425 5:179891059-179891081 GCCTGCCTTCTGGGCCCTGCAGG - Intronic
1002663099 5:180804062-180804084 GCCTCCACGCAGGGGCCTGCGGG - Intronic
1002770042 6:282676-282698 GACCCCGGGCAAGGCCCTGCGGG - Intergenic
1002888233 6:1313636-1313658 TCCTCCCCGCGGCGCCCTGCAGG + Exonic
1003191219 6:3876594-3876616 GGCTCCACGCAGGGCCATGCTGG + Intergenic
1004169829 6:13287333-13287355 GTCTTCAGTCAGGGCCCTGCTGG - Exonic
1004503179 6:16227029-16227051 GCCTCCCCGCAGGGCGGGGCGGG - Intergenic
1004535566 6:16497671-16497693 GCCTGGTGGCAGGGCCATGCTGG + Intronic
1005778089 6:29159919-29159941 GTCTCCCGGCCCAGCCCTGCGGG + Intergenic
1005778772 6:29165960-29165982 GTCTCCCGGCCCAGCCCTGCGGG - Intergenic
1006106356 6:31719250-31719272 GCCTCCTGACAGGGCTCTTCTGG + Exonic
1006866754 6:37214823-37214845 GCCTCCCTCCTGGGCCCTCCAGG - Intronic
1006902793 6:37513802-37513824 CCATCCCTGCAGGGCACTGCAGG - Intergenic
1011444732 6:87426081-87426103 GCCAACCTGCAGTGCCCTGCTGG + Intronic
1013459054 6:110358116-110358138 GCCGCCAGGCCGGGCCCGGCGGG + Exonic
1013793309 6:113859010-113859032 GCCTGCGGGCAGGGCCCGGCTGG + Intronic
1013866892 6:114709365-114709387 CTCTTCCGGCAGAGCCCTGCCGG + Intergenic
1015315070 6:131808090-131808112 GCTCCCCGGGAGGGCCCGGCGGG + Exonic
1017815323 6:158012086-158012108 ACCTCCCAGGAGGGCCCTGTAGG + Intronic
1017907019 6:158763892-158763914 GCCGCTCGGCAGGGCACCGCCGG + Intronic
1018906990 6:168081229-168081251 ACCTCCCGCCAGGGCACTGAGGG + Intronic
1019492958 7:1323673-1323695 GCCTCTCGGCTGGGCCTGGCAGG + Intergenic
1023056200 7:36291875-36291897 GCCCCCCAGCTGGGCTCTGCGGG - Intronic
1023601701 7:41887128-41887150 TATTCCCGGCAGGGCCCGGCAGG - Intergenic
1024354014 7:48396065-48396087 GGCTCCCACCAGGGCACTGCCGG + Intronic
1025145289 7:56496278-56496300 GCCTCCAGGTAGGGCCCTGTTGG + Intergenic
1025260890 7:57416777-57416799 GCCTCCAAGTAGGGCCCTGGTGG + Intergenic
1026825435 7:73578593-73578615 GCGGCCCGGCAGAGCCGTGCGGG - Exonic
1026996008 7:74617218-74617240 GTCCCCAGGCAGGGCCCTGCCGG - Intergenic
1027185443 7:75968218-75968240 TCCTCCTGGCGGGGACCTGCTGG + Intronic
1029406336 7:100376109-100376131 TCTTCCCTGCAGGGACCTGCAGG + Intronic
1029406339 7:100376114-100376136 CCGTCCCTGCAGGTCCCTGCAGG - Intronic
1029438532 7:100575256-100575278 GCCCCCGGGCAGTGCCCTGGAGG + Exonic
1030059650 7:105612581-105612603 GCCTCCAGGGAGAGCCCTGTGGG + Intronic
1034428646 7:151028647-151028669 ACCGCCCGGCAGGGCAGTGCCGG + Intronic
1034430053 7:151036687-151036709 GCCGCCCTCCAGAGCCCTGCTGG + Intronic
1035017942 7:155782624-155782646 GCCACCCGGCAGGACCCTGGGGG + Intergenic
1035103345 7:156419538-156419560 GCCTTCTGGCAGAGCCCTGGAGG - Intergenic
1035181131 7:157090468-157090490 TCCTCCAGCCAGGGCCCTGCAGG - Intergenic
1035425927 7:158773148-158773170 GCCTCCCAGCAGCTCCCGGCAGG + Intronic
1035719994 8:1784717-1784739 GCTGCCAGGCAGGGCCCTGCAGG + Exonic
1036135080 8:6152936-6152958 GCCTCCCCGCAGGGCAGGGCTGG + Intergenic
1036503609 8:9335606-9335628 TCCACACGGCAGGGCTCTGCAGG - Intergenic
1036621085 8:10424830-10424852 ATCTCCCTCCAGGGCCCTGCAGG - Intronic
1036706294 8:11049448-11049470 GCCTCTCTGCAGGGGGCTGCGGG + Intronic
1036709575 8:11069406-11069428 GGCTCCAGGGAGGGCCTTGCGGG - Intronic
1037757908 8:21723321-21723343 GTCTCCTGGCAGAGCCCTGAAGG - Intronic
1037811435 8:22089305-22089327 GCGGCCCGGCCCGGCCCTGCCGG - Intronic
1037879556 8:22566144-22566166 GAGGCCCGGCAGGGCCCAGCGGG - Intronic
1038022520 8:23562196-23562218 GGCTCCAGGCAGCGCCCTTCAGG - Intronic
1039212980 8:35236485-35236507 TCATCCCGGCTGGGCACTGCAGG - Intronic
1039454526 8:37698111-37698133 GCCTTCAGGCTGGGCCCGGCAGG - Exonic
1039454583 8:37698349-37698371 GGCTCCCGGCAGGGCCGTGTGGG - Exonic
1040599518 8:48870232-48870254 GCCTCCCGGCCGGGCGGTGGCGG - Intergenic
1040942087 8:52844287-52844309 AGCACCAGGCAGGGCCCTGCCGG + Intergenic
1042859029 8:73294989-73295011 GCCGGCCGGCCGGGCGCTGCGGG + Exonic
1044306424 8:90645798-90645820 ACCCCGCGGCAGGGCCCAGCGGG + Exonic
1044934130 8:97277403-97277425 TCTTCCCGGCAGGGCCACGCCGG + Exonic
1046149330 8:110202705-110202727 GCCTCCCCGCAGGGCAGGGCTGG - Intergenic
1048253009 8:132882913-132882935 GCCAGACGGAAGGGCCCTGCTGG + Exonic
1048295472 8:133210595-133210617 TCCTCCCTGCAGGGGGCTGCAGG + Intronic
1048963867 8:139601076-139601098 GCCCTCCTGCAGGGCCCGGCGGG - Intronic
1049203610 8:141353272-141353294 GCCTCCCTGTGGAGCCCTGCTGG + Intergenic
1049300809 8:141868455-141868477 GCCTCCCAGCAGTGCCCACCGGG + Intergenic
1049300821 8:141868493-141868515 GCCTCCCAGCAGTGCCCGCCGGG + Intergenic
1049752120 8:144289966-144289988 GCCTCTGAGCAGAGCCCTGCTGG + Intronic
1050472569 9:6008108-6008130 GCGACCCGGCAGGGCCTGGCCGG - Intergenic
1057437558 9:95056296-95056318 ACCTCCCGGCGTGGCCCAGCTGG - Intronic
1058749124 9:108021593-108021615 AGCTCCCTGCAGGGCACTGCTGG - Intergenic
1059395627 9:114032431-114032453 CCCTCCTGGCAGGGCCCAGGAGG - Intronic
1060406377 9:123375060-123375082 GTCACCTGGCAGGGCCCAGCTGG + Intronic
1060553463 9:124496547-124496569 CCCTCCCAGCAGGGCCCCTCTGG + Intronic
1060757259 9:126222961-126222983 CGCGCCCGGCAGGGCCCTGGAGG + Intergenic
1060757264 9:126222966-126222988 GTCCCCCTCCAGGGCCCTGCCGG - Intergenic
1060812696 9:126618985-126619007 GCCGCCCGGGCAGGCCCTGCGGG - Intronic
1061013850 9:127970931-127970953 CCCTCACTGGAGGGCCCTGCAGG + Intronic
1061060872 9:128250038-128250060 GCCGCCCCACCGGGCCCTGCTGG - Intronic
1061482269 9:130903084-130903106 GCCTCCCAGGAGGGCCTTGGGGG - Exonic
1061523794 9:131140320-131140342 GCTTCTAGGCAGGGCCCAGCAGG + Intronic
1061587437 9:131578150-131578172 GCCTGCAGGCAGGGCGCTGCGGG - Exonic
1062047599 9:134431685-134431707 CCCTCCGGGCAGGGCCAGGCAGG + Intronic
1062049484 9:134439615-134439637 GGCACCCAGGAGGGCCCTGCCGG + Intronic
1062049486 9:134439620-134439642 ACATTCCGGCAGGGCCCTCCTGG - Intronic
1062075405 9:134585958-134585980 GTCTCCCGGCCGGGCAGTGCCGG - Intergenic
1062160150 9:135075482-135075504 GCCTCCGGGCAGGGCTGGGCAGG - Intronic
1062266388 9:135688277-135688299 GCCTCCCTGGATGCCCCTGCTGG - Intergenic
1062279435 9:135745376-135745398 GCTTCCTGTCAGGGCCCGGCCGG - Intronic
1062452330 9:136620910-136620932 TCCTCCCGGCAGAGGCCTGCGGG - Intergenic
1062482091 9:136757236-136757258 ACCCCCGGGCAGGGGCCTGCTGG + Intronic
1062498008 9:136840665-136840687 GTCCCCAGGCTGGGCCCTGCAGG + Exonic
1062623677 9:137433703-137433725 GCCTCCTGGGTGGGGCCTGCAGG - Intronic
1062740929 9:138175125-138175147 GCCACCCGGCAGGCCCGGGCTGG - Intergenic
1189320789 X:40085908-40085930 GCCTCTCTGCAGGGCCTGGCGGG + Intronic
1193128545 X:77895511-77895533 GTCTCCCGGCAGGGCTGAGCTGG - Exonic
1199305178 X:146259062-146259084 GCCACCGCGCCGGGCCCTGCTGG + Intergenic
1199612607 X:149631292-149631314 GGCTCGCGGCCGGGCCCTTCCGG + Intronic
1200037276 X:153340122-153340144 TCACCCGGGCAGGGCCCTGCTGG - Intronic
1200128573 X:153829632-153829654 CCCTCCCCGCGGGGCCCTGCTGG + Intronic
1200135694 X:153873584-153873606 GCCCCCTGGCAGGGCCTGGCAGG + Intronic
1200163268 X:154019820-154019842 GCCGCCGGGCCGGGACCTGCCGG + Exonic
1202342637 Y:23886055-23886077 GCCACCCTGCAGTGACCTGCGGG + Intergenic
1202528132 Y:25784030-25784052 GCCACCCTGCAGTGACCTGCGGG - Intergenic