ID: 1160680120

View in Genome Browser
Species Human (GRCh38)
Location 19:408533-408555
Sequence CCGCCCAGGCGCGGCGGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 503
Summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 468}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160680114_1160680120 -10 Left 1160680114 19:408520-408542 CCCTGGGGGCGTCCCGCCCAGGC 0: 1
1: 0
2: 0
3: 9
4: 126
Right 1160680120 19:408533-408555 CCGCCCAGGCGCGGCGGCCCAGG 0: 1
1: 0
2: 2
3: 32
4: 468
1160680103_1160680120 19 Left 1160680103 19:408491-408513 CCTGCCGGCGGGGTGGGGGTGGA 0: 1
1: 0
2: 27
3: 37
4: 363
Right 1160680120 19:408533-408555 CCGCCCAGGCGCGGCGGCCCAGG 0: 1
1: 0
2: 2
3: 32
4: 468
1160680095_1160680120 29 Left 1160680095 19:408481-408503 CCGGCAGGGCCCTGCCGGCGGGG 0: 1
1: 0
2: 1
3: 40
4: 340
Right 1160680120 19:408533-408555 CCGCCCAGGCGCGGCGGCCCAGG 0: 1
1: 0
2: 2
3: 32
4: 468
1160680112_1160680120 -9 Left 1160680112 19:408519-408541 CCCCTGGGGGCGTCCCGCCCAGG 0: 1
1: 0
2: 1
3: 18
4: 161
Right 1160680120 19:408533-408555 CCGCCCAGGCGCGGCGGCCCAGG 0: 1
1: 0
2: 2
3: 32
4: 468
1160680093_1160680120 30 Left 1160680093 19:408480-408502 CCCGGCAGGGCCCTGCCGGCGGG 0: 1
1: 0
2: 3
3: 43
4: 340
Right 1160680120 19:408533-408555 CCGCCCAGGCGCGGCGGCCCAGG 0: 1
1: 0
2: 2
3: 32
4: 468
1160680101_1160680120 20 Left 1160680101 19:408490-408512 CCCTGCCGGCGGGGTGGGGGTGG 0: 1
1: 0
2: 5
3: 52
4: 437
Right 1160680120 19:408533-408555 CCGCCCAGGCGCGGCGGCCCAGG 0: 1
1: 0
2: 2
3: 32
4: 468
1160680106_1160680120 15 Left 1160680106 19:408495-408517 CCGGCGGGGTGGGGGTGGAGGGG 0: 1
1: 1
2: 22
3: 184
4: 1116
Right 1160680120 19:408533-408555 CCGCCCAGGCGCGGCGGCCCAGG 0: 1
1: 0
2: 2
3: 32
4: 468

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160680120 Original CRISPR CCGCCCAGGCGCGGCGGCCC AGG Intronic
900100371 1:959888-959910 CTGTCCAGGCCCGGGGGCCCGGG - Intergenic
900109736 1:1000391-1000413 CCGCCCAGCCCCGGGGGTCCCGG - Intergenic
900120698 1:1047518-1047540 CCGCCCAAGCCGGGCTGCCCTGG - Intronic
900148224 1:1167457-1167479 CCGCCCAGGCGCTGTGGGCAGGG - Intergenic
900162782 1:1232251-1232273 CCGCGCCGGGCCGGCGGCCCAGG - Exonic
900331316 1:2136057-2136079 CCTCACAGGAGCGGTGGCCCTGG + Intronic
900513023 1:3069335-3069357 GCGCCCCGGCCCGGCGGCCCGGG - Intronic
900514565 1:3075091-3075113 CCGGCCAGGCGGGCCAGCCCAGG - Intronic
900949146 1:5847802-5847824 CAGGCCAGGCGCGGTGGCTCAGG + Intergenic
902310161 1:15576035-15576057 CGGGCCAGGCGCGGTGGCTCAGG - Intronic
902477004 1:16693613-16693635 CGGCCCAGGCAAAGCGGCCCCGG + Intergenic
903184767 1:21622673-21622695 ACGCGCAGGCGCGGTGTCCCGGG - Intronic
903263501 1:22143305-22143327 GCGCCCAGCCGGGGAGGCCCCGG - Intronic
903266286 1:22159981-22160003 CCGCCCTGGCGCAAGGGCCCTGG - Intergenic
903778770 1:25808934-25808956 CAGCCCAGACCCGACGGCCCAGG - Intronic
904190168 1:28737208-28737230 CTGCCCAGGAGCGGCGGGCCCGG - Intronic
904500140 1:30908558-30908580 CCGGCACGGTGCGGCGGCCCCGG + Exonic
904658368 1:32066371-32066393 CTGGCCAGGCGCGGTGGCTCAGG - Intergenic
904782988 1:32964535-32964557 TGGCCCGGGCGCGGCGGCCGCGG + Exonic
905584348 1:39105339-39105361 CCGCCCCGGCGCGGCTGCAGCGG - Intronic
905867168 1:41382622-41382644 CCGGCCAGGCCCGGCGGCGGCGG - Exonic
905990701 1:42335022-42335044 CCGCCCAGGCCCGGCCGCCCTGG + Intronic
905991028 1:42336900-42336922 CAGGCCAGGCGCGGTGGCTCAGG - Intergenic
906197191 1:43936432-43936454 CTGCCCGAGCGCGGCTGCCCGGG - Exonic
906376951 1:45303775-45303797 CCTTCCAGAGGCGGCGGCCCCGG - Intronic
907240593 1:53078983-53079005 CCACCCAGGCACGGGGGCCCAGG - Exonic
907364171 1:53945977-53945999 CCGCCCCCTCGCGGCGGCCTCGG + Intergenic
908841631 1:68285822-68285844 TCGGCCAGGCGCGGTGGCTCAGG - Intergenic
910427633 1:87132415-87132437 CTGTCCCGGCGCGGCGGCCTCGG + Intronic
913091415 1:115479097-115479119 CCGCCCAGTCCCGGCAGCCTGGG - Intergenic
913453561 1:119008432-119008454 CTGGCCCGGCGCGGCGGGCCAGG + Intergenic
913653890 1:120943370-120943392 CAGGCCAGGCGCGGTGGCTCAGG - Intergenic
914519577 1:148403472-148403494 CAGGCCAGGCGCGGTGGCTCAGG - Intergenic
914644085 1:149637536-149637558 CAGGCCAGGCGCGGTGGCTCAGG - Intergenic
915161719 1:153924975-153924997 CCGGCCGGGCGCGGTGGCTCAGG + Intergenic
916076421 1:161202426-161202448 CGGCCCAGGTGCTGCGGCCTGGG + Exonic
916106991 1:161440256-161440278 CAGCCCCGCCGCGCCGGCCCGGG + Intergenic
916108552 1:161447670-161447692 CAGCCCCGCCGCGCCGGCCCGGG + Intergenic
916110140 1:161455051-161455073 CAGCCCCGCCGCGCCGGCCCGGG + Intergenic
916111725 1:161462461-161462483 CAGCCCCGCCGCGCCGGCCCGGG + Intergenic
916113312 1:161469842-161469864 CAGCCCCGCCGCGCCGGCCCGGG + Intergenic
916232805 1:162556983-162557005 CTGGCCAGGCGCGGTGGCTCAGG - Intergenic
918283009 1:183023736-183023758 CCGCGCCGGCCCTGCGGCCCCGG + Exonic
918388764 1:184037056-184037078 GCGTCCCGCCGCGGCGGCCCGGG + Intronic
918423670 1:184387420-184387442 CCGCCCCGGCTCGGCTACCCGGG + Intronic
919463241 1:197902936-197902958 CCGCCCCGCCGCGGCCGCCCCGG + Intronic
920017743 1:202927189-202927211 CCGCCCAGACCCGGAGGCTCTGG + Exonic
920021132 1:202957802-202957824 CTCCCCACGCGCGGCGGCCTCGG + Intronic
920646306 1:207806701-207806723 CAGTCCAGGCACGGGGGCCCTGG + Intergenic
921866703 1:220094240-220094262 CGGGCCGGGCGCGGCCGCCCTGG + Exonic
922764348 1:228149658-228149680 CCGCCCAGTCCAGGCGGCTCTGG - Intergenic
924031471 1:239889704-239889726 CAGCCCAGGTGTGGCAGCCCAGG - Intronic
924042504 1:239997767-239997789 CCCCCCAGGACTGGCGGCCCCGG + Intergenic
924188291 1:241519506-241519528 CCGCCAAGTCGCGGGCGCCCAGG + Intronic
924198980 1:241640258-241640280 CCCGCCAGGCGCGCCGGCGCCGG - Exonic
924527112 1:244863192-244863214 CCGCCAAAGCGCGCCCGCCCCGG + Intronic
1062843829 10:689820-689842 CCCCGCAGGCGCTGCGGACCCGG + Intergenic
1064044198 10:11996623-11996645 CAGGCCAGGCGCGGTGGCTCAGG - Intronic
1064120780 10:12616796-12616818 TCGGCCAGGCGCGGTGGCTCAGG - Intronic
1065102950 10:22349128-22349150 CTACCCAGGCGTGGCGGCTCAGG - Intronic
1065342985 10:24723705-24723727 CCGGCCGGGGGCGGCGGCCTCGG - Intergenic
1065844716 10:29735541-29735563 GCGCCCCGTCGCAGCGGCCCGGG + Intronic
1066189850 10:33046341-33046363 CCGGCCAGGCGCAGTGGCTCAGG + Intergenic
1069705735 10:70458333-70458355 CCGGCCAGGCGCGGCGGGGCGGG - Intergenic
1070606878 10:77904845-77904867 CCGGCCGGGCGCGGTGGCTCAGG + Intronic
1072706922 10:97687441-97687463 CCGCCCCCGCGCGGCGCCCGAGG + Intergenic
1073088536 10:100912714-100912736 CCGCCCCCGCGCGCCGGCCAAGG + Intronic
1075627465 10:123973033-123973055 CCGCCCCGGCCTGGCGGCCGAGG - Intergenic
1076572171 10:131439961-131439983 GCGCCCAGGTGAGGAGGCCCTGG - Intergenic
1076792832 10:132785996-132786018 CCGCCCCTGCCCGCCGGCCCGGG + Exonic
1077155302 11:1088422-1088444 CGGCCCAGGAGCGGCGGTGCGGG - Intergenic
1077232086 11:1462287-1462309 CAGCCCGGGTGCGGCGGCCGTGG + Intronic
1077320963 11:1941828-1941850 GTGCCCAGGCCCTGCGGCCCGGG + Intergenic
1077337182 11:2010670-2010692 GGGCCCAGGAGCGGGGGCCCAGG - Intergenic
1077378037 11:2214789-2214811 CCGGCCTGGCGAGGAGGCCCAGG - Intergenic
1077500808 11:2909106-2909128 CTGCCCAGGCGGGGCTGACCAGG - Intronic
1077533834 11:3109679-3109701 CCGCCCAGGCTTGGCCGCTCTGG - Intronic
1077635867 11:3840995-3841017 CCGGCGAGGCGGGGCGGGCCGGG + Intergenic
1078246221 11:9574540-9574562 CCCCTCCGGCGCCGCGGCCCCGG - Intronic
1078771744 11:14358553-14358575 CCTCCCGGGCGCGGCGTCGCGGG - Intronic
1078987054 11:16607056-16607078 CCGCCCCGGCCCGGCAGCCGCGG + Intronic
1080045771 11:27806273-27806295 CCGCCCACGCCGGGCGGCCGAGG - Intergenic
1081831976 11:46121706-46121728 GGGCCGAGGCGCGGGGGCCCGGG - Intergenic
1081969092 11:47186114-47186136 CCGCCCGGGGGAGGCGGCGCCGG - Intronic
1083221747 11:61257274-61257296 CCGGCCCGGCGCGGTGGCTCAGG + Intergenic
1083335147 11:61917665-61917687 CTGTCCCGGCGCGGCGGGCCGGG - Intronic
1083888713 11:65585252-65585274 CCGCGCAGACGGGGCGGCCCCGG + Exonic
1083904827 11:65662768-65662790 CGCCACAGCCGCGGCGGCCCCGG + Intronic
1083980319 11:66162401-66162423 CAGGCCAGGCGCGGTGGCTCAGG - Intronic
1084758086 11:71251782-71251804 CGCACCAGGCGCGCCGGCCCCGG + Intronic
1085561269 11:77474206-77474228 CCTCCCCGGCGCGGCGGCGGCGG + Intronic
1086064906 11:82733806-82733828 CCGCCCCGGCGCGGCGCGCGCGG + Exonic
1089064759 11:115654085-115654107 CCACCCAGCCTCGGCCGCCCAGG + Intergenic
1089694908 11:120211040-120211062 CCGGCCCGGCTCCGCGGCCCCGG - Exonic
1202820166 11_KI270721v1_random:65852-65874 GGGCCCAGGAGCGGGGGCCCAGG - Intergenic
1092861515 12:12724045-12724067 CGGCGGAGGCGCGGCCGCCCGGG - Intergenic
1094838883 12:34334747-34334769 CCGCGCATGCGCGGGGTCCCTGG + Intergenic
1094841113 12:34343088-34343110 CCGCACATGCGCGGTGTCCCAGG + Intergenic
1094841970 12:34346000-34346022 CCGCGCATGCGCGGGGTCCCGGG - Intergenic
1094842835 12:34349174-34349196 CCGCACATGCGCGGTGTCCCAGG - Intergenic
1094843195 12:34350467-34350489 CCGCACATGCGCGGTGTCCCGGG - Intergenic
1095394307 12:41744579-41744601 CAGGCCAGGCGCGGTGGCTCAGG - Intergenic
1096512560 12:52139426-52139448 CCGGCCAGGCGCAGTGGCTCAGG - Intergenic
1096983717 12:55743357-55743379 TCGCCCTGGAGCTGCGGCCCCGG + Exonic
1097178638 12:57158327-57158349 CCACCCAGGGGCTGCGGCCAAGG - Intronic
1099452480 12:82824173-82824195 TAGGCCAGGCGCGGTGGCCCAGG - Intronic
1100251937 12:92835160-92835182 CTGGCCAGGCGCGGTGGCTCAGG - Intronic
1102475388 12:113185346-113185368 GCGCCGAGGCGCGGCCTCCCAGG - Exonic
1105049757 12:133037761-133037783 ACGCCCAGGAGCGGCGCCTCCGG - Exonic
1107364446 13:39655619-39655641 CCGCGCATGCGCATCGGCCCCGG - Intronic
1107467984 13:40666455-40666477 CTGCCCCGGCCCGGCGGCTCTGG - Exonic
1107604038 13:42040838-42040860 CCGCCCGGGCGCGCAGACCCGGG - Intronic
1107951242 13:45464381-45464403 CAGACCAGGCGCGGGGGCTCAGG - Intergenic
1112084377 13:96014995-96015017 GCGGCCAGGCGCGGTGGCTCAGG + Intronic
1113338150 13:109396570-109396592 ACGGCCAGGCGCGGTGGCTCAGG + Intergenic
1113654743 13:112061112-112061134 CCGGCCAGGCGCGGCTCCCGGGG + Intergenic
1113655705 13:112066983-112067005 CATCCCGGGCTCGGCGGCCCCGG + Intergenic
1113775632 13:112943465-112943487 GGGCCGGGGCGCGGCGGCCCGGG + Intronic
1113841175 13:113362730-113362752 CCGCCCAGGTGCAGGGCCCCTGG + Intronic
1114286962 14:21253782-21253804 GCGGCCAGGCGCGGTGGCTCAGG + Intronic
1115398558 14:32934810-32934832 GCCCCCGGGCGCGGCGGCTCTGG - Intergenic
1115582262 14:34772747-34772769 CCGGCCAGGCGTGGTGGCTCAGG + Intronic
1116436259 14:44897754-44897776 CCTCCCGGGCGCGGCTGCCCAGG + Intronic
1116653767 14:47626655-47626677 CCGGCCAGCCCCGTCGGCCCGGG + Intronic
1119357541 14:74019425-74019447 TTGCCCAGCCGCGGCCGCCCTGG - Exonic
1119469046 14:74882142-74882164 CCGCGCGGGCTGGGCGGCCCGGG + Intronic
1119500883 14:75126729-75126751 CCCCGAAGGCGCCGCGGCCCAGG + Exonic
1119743527 14:77028525-77028547 GCCGCCAGCCGCGGCGGCCCGGG - Exonic
1120780038 14:88479070-88479092 CCGCAGAGGCCCAGCGGCCCTGG - Exonic
1120881345 14:89417157-89417179 CCGCCGCGGCGCGTCGGGCCGGG + Intronic
1121293204 14:92794393-92794415 CCGCCGAGGGGGCGCGGCCCAGG + Exonic
1122316173 14:100827224-100827246 CCCACCAGGCCCGCCGGCCCAGG - Intergenic
1122550400 14:102546032-102546054 CTGCCTAGGCGAGGTGGCCCAGG + Intergenic
1122975051 14:105167623-105167645 GCGCCCAGGCGGGGCGGGGCCGG - Intronic
1123001975 14:105300708-105300730 CCGCCCAGGCCCAGCCGCCCAGG + Exonic
1123500814 15:20878826-20878848 CTGCCCCTGCGCGCCGGCCCTGG + Intergenic
1123558065 15:21452521-21452543 CTGCCCCTGCGCGCCGGCCCTGG + Intergenic
1123594293 15:21889802-21889824 CTGCCCCTGCGCGCCGGCCCTGG + Intergenic
1123720678 15:23059029-23059051 CAGGCCAGGCGCGGTGGCTCAGG - Intergenic
1124118459 15:26868078-26868100 CTGCCCTGGCGCGCCGGCCCTGG + Intronic
1124377833 15:29139945-29139967 CAGCCCAGGCACGGCAGCCTGGG - Intronic
1124500856 15:30225455-30225477 CGGGCTGGGCGCGGCGGCCCGGG - Intergenic
1124526903 15:30463244-30463266 CCGGCCAGGCGCAGTGGCTCAGG + Intergenic
1124742714 15:32313212-32313234 CGGGCTGGGCGCGGCGGCCCGGG + Intergenic
1124771750 15:32544439-32544461 CCGGCCAGGCGCAGTGGCTCAGG - Intergenic
1124938823 15:34199155-34199177 CCGGCCAGGCGCAGTGGCTCAGG + Intronic
1125508912 15:40282589-40282611 CTGCCCGGGCGCGGCGGCCGGGG - Intronic
1125991452 15:44112747-44112769 CAGGCCAGGCGCGGTGGCTCAGG - Intronic
1127117394 15:55742438-55742460 ACGTGCAGCCGCGGCGGCCCCGG + Intronic
1127904253 15:63364666-63364688 CTGCCCAGGCCCTGCAGCCCTGG + Intronic
1128067996 15:64775995-64776017 CCGCCCGGGCAGGGCCGCCCAGG - Intergenic
1128177127 15:65565660-65565682 CATCACAGGCGCGGAGGCCCAGG - Intronic
1128189432 15:65677488-65677510 CCGGCCAGGCACGGTGGCTCAGG - Intronic
1128264013 15:66252576-66252598 CCGCCCGGGCTCGGGGGCTCTGG + Intronic
1128374319 15:67065058-67065080 CAGCCCAGGGGCGCCGGCGCCGG + Intronic
1128743885 15:70100503-70100525 CCGGCGAGGCGCCGCGTCCCTGG - Intergenic
1128992504 15:72272547-72272569 CCGCCCCCGCGGGGCGTCCCGGG - Exonic
1129608874 15:77037884-77037906 CAGCCCAGGCACGTTGGCCCCGG + Intergenic
1129772079 15:78208751-78208773 CCTCCCAGGCTCGGTGACCCTGG + Intronic
1130580270 15:85131036-85131058 CAGGCCAGGCGCGGTGGCTCAGG - Intronic
1131142125 15:89985466-89985488 CTGCCCAGGCATGGCGGCTCAGG - Intergenic
1131977615 15:97961363-97961385 CCGGTCAGGCCCGGCGGGCCAGG - Intronic
1132041131 15:98525299-98525321 CGGCCCAGGAGAGGTGGCCCTGG - Intergenic
1132067020 15:98739871-98739893 CAGGCCAGGCGCGGTGGCTCAGG - Intronic
1132255573 15:100373479-100373501 CCGGCCAGGCGCGGCGGCGGCGG + Intergenic
1202966415 15_KI270727v1_random:179693-179715 CTGCCCCTGCGCGCCGGCCCTGG + Intergenic
1132509014 16:327608-327630 CAGCACAGGCGGGGCAGCCCTGG + Intronic
1132641607 16:980872-980894 CCCCTCCGGCGGGGCGGCCCTGG - Intronic
1132688507 16:1172126-1172148 CGGCCCACGCCCTGCGGCCCGGG - Intronic
1132861697 16:2074932-2074954 CTGGCCAGGCGCGGTGGCTCAGG + Intronic
1132947214 16:2538204-2538226 CCGGCGAGGCGGGGCGGCCCGGG + Intronic
1132968501 16:2673252-2673274 GCGGCGAGGCGGGGCGGCCCGGG - Intergenic
1132971385 16:2690969-2690991 CAGCCCAGGCGCGAGGGCCTCGG - Intronic
1133021631 16:2969459-2969481 CCGCCCCGGCGCGGGGGCGACGG + Exonic
1133032362 16:3017559-3017581 CCGCCCAGGCCTGGGGCCCCCGG - Intronic
1133040882 16:3059245-3059267 CCGCGCAGGGGCGGCGGCGGCGG + Exonic
1133241596 16:4417152-4417174 CCGGCCAGGCGCGGTGGCTCAGG + Intronic
1133259421 16:4538555-4538577 CCGCCCAGGCGCCGCGGGCGGGG + Intronic
1133464941 16:6019807-6019829 CCGCCCTGGCGCGCCTGCCTGGG - Intronic
1134519354 16:14911624-14911646 CCGCCCGCGCGCGGAGGCCGCGG - Intronic
1134554579 16:15154604-15154626 CCGCCCGCGCGCGGAGGCCGCGG + Intergenic
1134707024 16:16310279-16310301 CCGCCCGCGCGCGGAGGCCGCGG - Intergenic
1134960516 16:18401845-18401867 CCGCCCGCGCGCGGAGGCCGCGG + Intergenic
1135607499 16:23836602-23836624 GCGCCCAGGGGCGGCGTCGCGGG + Intronic
1136269778 16:29141716-29141738 CCACCCAGCCTCGGCGTCCCAGG - Intergenic
1136413901 16:30092063-30092085 CCGCCTAGGGGCAGCGTCCCAGG - Intergenic
1136520272 16:30791083-30791105 CAGGCCAGGCGCGGTGGCTCAGG - Intergenic
1137421050 16:48334420-48334442 CTGCCCAGGCCCTACGGCCCTGG - Intronic
1138360749 16:56425441-56425463 CCGGCCCGGCGCGGCGGCGGCGG - Exonic
1139597889 16:67968689-67968711 CCGCCCCCGAGGGGCGGCCCGGG - Exonic
1141538640 16:84700452-84700474 CCGGCCGGGGGAGGCGGCCCGGG + Intronic
1142188596 16:88706577-88706599 CGCCCCCGGCGCCGCGGCCCAGG + Exonic
1142206381 16:88785033-88785055 CAGCCATGGCGCGCCGGCCCCGG - Exonic
1142283739 16:89162520-89162542 CCCTCCAGGTGCGGCTGCCCCGG + Intergenic
1142309665 16:89305132-89305154 CAGCCCAGGCAGGGCGTCCCTGG - Intronic
1142393278 16:89816414-89816436 CCCCCCGGGCGCGGCGTCCGGGG + Intronic
1142576222 17:909817-909839 CCGGCCGGGCGCGGTGGCTCAGG - Exonic
1142601192 17:1053741-1053763 CCGCCCAGGCTGGGAGGCCACGG + Intronic
1142810517 17:2393655-2393677 CCGCCCAGGCTCTGCGGCCGGGG + Intronic
1143053695 17:4146669-4146691 CGGGCCAGGCGCGGTGGCTCAGG - Intronic
1144339745 17:14301679-14301701 CAGCCCCGGCGCGGCGGCGCAGG - Exonic
1144369170 17:14573778-14573800 TCGGCCAGGCGCGGTGGCTCAGG + Intergenic
1144775304 17:17782154-17782176 CCGCGCAGGGGCGGGGGCCGCGG + Intronic
1146058720 17:29593584-29593606 CCGGCCGGGCGCCGCGGCCCCGG + Exonic
1146339376 17:32006809-32006831 CCCTCCAGGCGTGGCAGCCCGGG + Intergenic
1147684058 17:42276429-42276451 CCGCTCACGCGCGGAGGCCCAGG + Intronic
1147745090 17:42690019-42690041 CTGGCCAGGTGCGGCGGCTCGGG - Intronic
1148111900 17:45149286-45149308 CCCCCCAGGCGCGGAGGAGCGGG + Exonic
1148178199 17:45585286-45585308 GCGCCCAGCCCCGGCGCCCCAGG - Intergenic
1148733372 17:49851234-49851256 CCGCCCGGTCCCCGCGGCCCCGG + Intergenic
1149823753 17:59807476-59807498 CCGGCCGGGCGCGGTGGCTCAGG - Intronic
1150239942 17:63622915-63622937 CCGCTCGCGCGCCGCGGCCCGGG + Intronic
1150408098 17:64919576-64919598 GCGCCCAGCCCCGGCGCCCCAGG - Intergenic
1150675745 17:67245030-67245052 GACCCCGGGCGCGGCGGCCCCGG - Intronic
1151662467 17:75525911-75525933 CCGCCCTGGCCCGACAGCCCAGG - Intronic
1151910608 17:77080362-77080384 CAGGCCAGGCGCGGTGGCTCAGG - Intergenic
1152362608 17:79839563-79839585 CCGCCCAGGCCCGGGGCCTCCGG - Intergenic
1152528952 17:80905796-80905818 CCCCCCACTCCCGGCGGCCCTGG - Intronic
1152711110 17:81870961-81870983 CCGCCGAGGCGCGTGGGGCCCGG - Intronic
1152760634 17:82105510-82105532 CCTCCCAGGCGTGGGGACCCTGG - Intronic
1152821589 17:82440296-82440318 ACCCGCAGGCGCGGCGGCCCAGG + Intronic
1153805447 18:8705821-8705843 CGGGCCGGGCGCGGCGGGCCGGG - Intronic
1153911278 18:9708343-9708365 GGGCGCGGGCGCGGCGGCCCCGG + Exonic
1154066353 18:11110698-11110720 CCGCCCCGGCCCGCCCGCCCCGG + Intronic
1154210932 18:12377638-12377660 CTGCCCAGGCTCGGAAGCCCAGG - Intergenic
1154304089 18:13218073-13218095 CCGCTCCGGGGGGGCGGCCCAGG + Intronic
1156411146 18:36829086-36829108 AGGCCGAGGCGTGGCGGCCCAGG + Intronic
1159057075 18:63476870-63476892 CCGCCGAGGCGGGGCGGGGCGGG + Exonic
1159256473 18:65953770-65953792 CGGTCCAGGCGCGGTGGCTCAGG - Intergenic
1159581123 18:70235677-70235699 CCTCCAAGGCGTGGAGGCCCCGG - Intergenic
1160242321 18:77132676-77132698 GCGCCCACGCGCGGGGTCCCCGG + Exonic
1160543652 18:79638755-79638777 CTGTCCAGACGCGGCGGCGCTGG + Intergenic
1160680120 19:408533-408555 CCGCCCAGGCGCGGCGGCCCAGG + Intronic
1160698534 19:495817-495839 CCGCCCCTGTGCGGCCGCCCGGG + Intronic
1160725514 19:616365-616387 CGGGCTGGGCGCGGCGGCCCGGG - Exonic
1160823445 19:1068524-1068546 CCGCGCTGGCGTGGCGGCTCAGG - Exonic
1161022137 19:2015533-2015555 CGGCCCAGGGGCGGCGGCGGCGG + Exonic
1161038109 19:2096552-2096574 CCGCCCACAGGCCGCGGCCCCGG - Intronic
1161215620 19:3094038-3094060 CGGCCCAGGCGCGGTGGCGGAGG - Intergenic
1161284688 19:3463267-3463289 CGGCAGAGGCGCGGGGGCCCGGG - Intronic
1161412514 19:4124204-4124226 CTGCGCAGGCGCGGCGGCTGGGG - Intergenic
1161487578 19:4544059-4544081 GGTCCCAGGCGCGGGGGCCCAGG + Exonic
1161494911 19:4581470-4581492 CCGCGCACTCGCGGCGGCCGCGG - Intergenic
1161611251 19:5244192-5244214 CCGCACAGGCGAGCAGGCCCCGG - Exonic
1161668961 19:5593914-5593936 ACGAGCAGGAGCGGCGGCCCGGG - Exonic
1161802649 19:6424581-6424603 CCCGCCAGGCGCGGGGGACCGGG - Exonic
1161925129 19:7294129-7294151 CCCCCCGGCCGCTGCGGCCCGGG + Intergenic
1161959555 19:7516208-7516230 CGGCGCGGGCGCGGCGGGCCGGG + Exonic
1162344233 19:10110409-10110431 CCCCCCACCCCCGGCGGCCCCGG - Intronic
1162435907 19:10658578-10658600 CTGGCCAGGCGCGGTGGCTCAGG + Intronic
1162524140 19:11197639-11197661 CCGCCCGGGCGCCCCGGCCGCGG + Intronic
1162535268 19:11259861-11259883 AAGGCCGGGCGCGGCGGCCCAGG - Intronic
1162697497 19:12487568-12487590 CGGGCCAGGCGTGGTGGCCCAGG - Intronic
1162959619 19:14118090-14118112 CCGCCCCGCCCCGCCGGCCCGGG - Intergenic
1163118066 19:15200149-15200171 CCGCGCAGGGGCGGGGTCCCAGG + Intronic
1163634546 19:18431996-18432018 CCGCCCATGCTCGGATGCCCTGG - Exonic
1163660657 19:18575179-18575201 CTGCCCAGGCCCCGTGGCCCTGG + Exonic
1163807237 19:19406402-19406424 CCGCTCAGGGGCGGGGGTCCGGG + Intronic
1164835081 19:31350766-31350788 CCGCTCAGCCGCCGCCGCCCGGG - Intergenic
1165058612 19:33194395-33194417 CCGCCCGGCCCCGGCGTCCCCGG - Intronic
1165092491 19:33394381-33394403 CCGCCCAGATGTGCCGGCCCGGG + Intronic
1165992850 19:39826057-39826079 CCTCCCAGCCGCTGCGGCCCTGG - Exonic
1166043813 19:40218011-40218033 TCGCTGAGGCGCGCCGGCCCGGG + Exonic
1166080196 19:40439358-40439380 CAGGCCAGGCGCGGTGGCTCAGG - Intergenic
1166746676 19:45145086-45145108 CCCCCCAGGCGCGGTGGCGGTGG + Exonic
1166901261 19:46065586-46065608 CCAGCCAGGCGCGGTGGCTCAGG - Intronic
1167369511 19:49072276-49072298 CGGGCTGGGCGCGGCGGCCCTGG - Exonic
1168108901 19:54181035-54181057 CCGGCCAGGCGCGGCGCAGCAGG + Exonic
1168146568 19:54422644-54422666 CTGGCCAGGCGCGGTGGCTCAGG + Intronic
1168307312 19:55442641-55442663 CGGGGCGGGCGCGGCGGCCCGGG - Exonic
1168346572 19:55652876-55652898 GCCCCCAAGCGCGACGGCCCCGG + Exonic
1202711021 1_KI270714v1_random:19439-19461 CGGCCCAGGCAAAGCGGCCCCGG + Intergenic
927053331 2:19350256-19350278 CAGCCCTGGAGGGGCGGCCCAGG - Intergenic
927156510 2:20224342-20224364 GCGCCCGGGCTCGGCGGCGCTGG + Intronic
927472272 2:23385401-23385423 CCCCGCAGCCGCGGCGGCCGCGG - Exonic
927896951 2:26788954-26788976 ACGGCCAGGCGCAGCGGCTCAGG - Intronic
928617956 2:33057690-33057712 CCGGCCAGCCGTGCCGGCCCCGG - Intronic
931321373 2:61177377-61177399 CCGCCCTGCCGCGGCGCGCCCGG - Intergenic
931868141 2:66433489-66433511 CAGCCAATGCGCGGCGGCCTGGG + Intronic
932761679 2:74442051-74442073 CCGACCTGGCCCGACGGCCCCGG + Intronic
932767723 2:74481990-74482012 CCGACCAGGCCCAGCAGCCCTGG + Exonic
933139794 2:78779092-78779114 CCGGCCAGCCCCGCCGGCCCCGG + Intergenic
935196631 2:100820205-100820227 CGGCCCAGGAGCGGCGGCCGCGG + Exonic
936041820 2:109155580-109155602 CCGGCCAGGCACGGTGGCTCAGG - Intronic
936104832 2:109614840-109614862 GCTCCCCGACGCGGCGGCCCCGG + Exonic
936153420 2:110033730-110033752 CCGCCCAGGCACACCTGCCCTGG + Intergenic
936191261 2:110337685-110337707 CCGCCCAGGCACACCTGCCCTGG - Intergenic
936433243 2:112482180-112482202 GCGCCCGGGCGCGGCGCCGCCGG + Exonic
938302842 2:130228694-130228716 CTGTCCAGGCCCGGGGGCCCGGG + Intergenic
938453827 2:131445528-131445550 CTGTCCAGGCCCGGGGGCCCGGG - Intergenic
939360695 2:141169002-141169024 CTGGCCAGGCGCGGTGGCTCAGG + Intronic
939580137 2:143937456-143937478 ACGCCCCGGCACGCCGGCCCCGG - Intergenic
939629826 2:144517480-144517502 CCGCCCAGGGGAGCCGGGCCAGG + Intronic
939969667 2:148644971-148644993 CCGCCCCGCCGCCGCCGCCCGGG + Exonic
941031876 2:160521235-160521257 CAGGCCAGGCGCGGTGGCTCAGG - Intergenic
942019679 2:171854285-171854307 CAGGCCAGGCGCGGTGGCTCAGG + Intronic
945988221 2:216371636-216371658 CTGCCCGGGCGCGGGGGCTCAGG - Exonic
946311288 2:218883770-218883792 CCGTCCAGAAGCGGCTGCCCGGG + Intronic
946339176 2:219057379-219057401 CTGCCCATGCCCTGCGGCCCCGG + Intronic
946376495 2:219312918-219312940 CCGGCCAGCCCCGCCGGCCCCGG + Intergenic
946692483 2:222319751-222319773 GCGCTCAGGCGCGGCGGCAGCGG + Intergenic
948116179 2:235495281-235495303 CCGCCCAAACACGCCGGCCCGGG - Intronic
948255748 2:236567278-236567300 CCGGCCGGGCGCGGTGGCTCAGG - Intergenic
948781351 2:240323825-240323847 CCGCCCAGGCACAGCGGCAGGGG - Intergenic
948945562 2:241217502-241217524 CCGGTCAGGAGAGGCGGCCCTGG + Intronic
1169065483 20:2692619-2692641 CCGCCCCGCCGCCGCGGCCCGGG + Intergenic
1169214730 20:3786515-3786537 CCGCCCCGGGGCGGCGGCGGCGG - Exonic
1169214739 20:3786524-3786546 CCGCCCCGGGGCGGGGGGCCCGG + Exonic
1169244541 20:4015387-4015409 CAGCCCGGGGGCGGCGGCCGCGG + Intronic
1169557570 20:6767517-6767539 CCACCCCGCCGCGGCTGCCCGGG + Intergenic
1169988512 20:11473508-11473530 CCGGCCAGGTGCGGTGGCTCAGG + Intergenic
1171499905 20:25585440-25585462 CCTCCCAGGTGAGCCGGCCCGGG - Exonic
1172277202 20:33686216-33686238 CGGCCCATGCGCGCCGGCGCTGG - Exonic
1172474483 20:35226750-35226772 CCGGCGCGGCGCGGCCGCCCCGG - Exonic
1173300019 20:41794232-41794254 CAGGCCAGGCGCGGTGGCTCAGG - Intergenic
1174204236 20:48827737-48827759 CGGCCCGTGCGCGGCCGCCCGGG - Exonic
1174246848 20:49188139-49188161 CCGCCCAGGACCGCCGGCCGGGG - Exonic
1174585550 20:51605335-51605357 GCGGCCAGGCGCGGGGGCTCAGG + Intronic
1174736713 20:52972195-52972217 GGGCCCCGGCGCGCCGGCCCAGG - Intergenic
1176041182 20:63066663-63066685 CTGCCCAGGCGTGGCTGCCCTGG - Intergenic
1176125206 20:63472027-63472049 CCGCCGGGGAGCGCCGGCCCCGG + Intronic
1176549079 21:8213728-8213750 CCGCTCCGGCGGGGCGGCGCGGG + Intergenic
1176556973 21:8257948-8257970 CCGCTCCGGCGGGGCGGCGCGGG + Intergenic
1176568011 21:8396766-8396788 CCGCTCCGGCGGGGCGGCGCGGG + Intergenic
1176575915 21:8440985-8441007 CCGCTCCGGCGGGGCGGCGCGGG + Intergenic
1176604821 21:8820190-8820212 CTGCCCAGGGGCGGCTGCACCGG + Intergenic
1176931696 21:14819892-14819914 CAGGCCGGGCGCGGCGGCACAGG - Intergenic
1177010989 21:15730125-15730147 CCGCTCGTCCGCGGCGGCCCGGG - Exonic
1177788231 21:25695495-25695517 CCTCCCAGACGGGGCGGCCGCGG + Intronic
1178314904 21:31559393-31559415 CAGCGGAGGCGCGGCGGGCCGGG + Intronic
1178334447 21:31731524-31731546 CCGCGCAGGCCCCGCCGCCCCGG + Intronic
1178400135 21:32278612-32278634 CCGCCCACGCGCGGCACCCCTGG + Intronic
1178493759 21:33070513-33070535 CCGGCCGGGCGCTGCCGCCCGGG - Exonic
1178716230 21:34967068-34967090 CAGGCCGGGCGCGGCGGCCAAGG + Intronic
1179615303 21:42579637-42579659 CCGCCCAGGCCTTGCGGGCCAGG + Intronic
1179778008 21:43680276-43680298 TCGGCCGGGCGCGGTGGCCCAGG + Intronic
1179968128 21:44818387-44818409 GCGGCCATGGGCGGCGGCCCCGG - Intronic
1179972882 21:44845993-44846015 CAGCCCCGGCGCTCCGGCCCAGG - Intergenic
1180042836 21:45288621-45288643 CAGCGCAGGGGCGGCAGCCCCGG - Intergenic
1180347111 22:11711795-11711817 CTGCCCAGGGGCGGCTGCACCGG + Intergenic
1180354861 22:11829885-11829907 CTGCCCAGGGGCGGCTGCACCGG + Intergenic
1180383390 22:12162446-12162468 CTGCCCAGGGGCGGCTGCACCGG - Intergenic
1180891259 22:19291163-19291185 CCTCCCAGGCGAAGCCGCCCTGG + Intronic
1181087701 22:20449943-20449965 CCGCCCCGGCCCGGAGGCTCTGG - Intronic
1181652963 22:24271047-24271069 ACGCCCGGGCGCGGCAGCGCGGG - Intronic
1182475489 22:30574506-30574528 GCGCCCGGGCGGCGCGGCCCGGG - Intronic
1182903793 22:33920267-33920289 CTGCCCATGCGGGGCGCCCCTGG - Exonic
1183211140 22:36452106-36452128 CTGGCCAGGCGCGGTGGCTCAGG + Intergenic
1183253602 22:36746699-36746721 CAGCCCAGCCGAGGAGGCCCTGG + Intergenic
1183350951 22:37334635-37334657 GCGCCCAGGCGGGGCCGCCGCGG - Intergenic
1183393851 22:37560704-37560726 CCGCCCGGGAGAGGCGCCCCCGG + Intronic
1184281964 22:43442491-43442513 CCGCACAGGGGCGGGTGCCCAGG - Intronic
1184676267 22:46045024-46045046 CCGCCCTCGCCCGGCGGCGCTGG + Intergenic
1184680788 22:46071337-46071359 CCGCCCGCGCGCGCCGTCCCGGG + Intronic
1185351437 22:50341711-50341733 CTGGCCGGGCGCGGCGGCTCAGG + Intergenic
1203253966 22_KI270733v1_random:130043-130065 CCGCTCCGGCGGGGCGGCGCGGG + Intergenic
1203262022 22_KI270733v1_random:175122-175144 CCGCTCCGGCGGGGCGGCGCGGG + Intergenic
950386364 3:12663726-12663748 CCACCCAGGCCCGGTCGCCCTGG + Intronic
952031562 3:29148710-29148732 CTGGCCAGGCGCGGTGGCTCAGG - Intergenic
952816476 3:37452054-37452076 CCGTCCAGCCGCCGCCGCCCGGG + Intergenic
954277951 3:49554651-49554673 CCGCCCGGCGGCGCCGGCCCCGG + Exonic
954912699 3:54122400-54122422 CGGCCCCGCCTCGGCGGCCCCGG - Intergenic
955687626 3:61562384-61562406 CCGCCGAGGGGATGCGGCCCCGG + Intronic
956528186 3:70187715-70187737 CCGGCCGGGCGCGGTGGCTCAGG - Intergenic
957917129 3:86699533-86699555 TCGGCCAGGCGCGGTGGCTCAGG - Intergenic
959677570 3:109054000-109054022 CTGCCCAGGCGTGGTGGCTCAGG + Intronic
959749394 3:109815207-109815229 TCGGCCAGGCGCGGTGGCTCAGG + Intergenic
960582743 3:119294678-119294700 CGGCCTCGGCACGGCGGCCCCGG + Exonic
960691195 3:120348669-120348691 GTGCCCAGGCCCGGCGCCCCAGG + Intronic
961202575 3:125056158-125056180 CCGGCCCCGCGCGGCGGGCCCGG + Intergenic
962263178 3:133927704-133927726 CCGCCCCTCCGCCGCGGCCCGGG - Intergenic
963904617 3:150763212-150763234 CCGCCCAGGCGCGCGGGGACTGG + Exonic
965590365 3:170356816-170356838 CCGCCCCGCCCCGGCGGCCCCGG - Intergenic
965962055 3:174440904-174440926 TCGCCCCCGAGCGGCGGCCCCGG - Intronic
966181899 3:177196552-177196574 CGGCCCGGGCGCGGCGACCCCGG - Intronic
966919863 3:184604367-184604389 TCGCCCCGGCGCGGGGGCTCCGG - Intronic
968235903 3:197029875-197029897 CCGCCCAGGGGCGGGGTCCGGGG - Intergenic
968258176 3:197297952-197297974 CCGCGGGGGTGCGGCGGCCCAGG - Intronic
968571641 4:1345347-1345369 AGGCCCAGGCACGGTGGCCCAGG + Intergenic
969239255 4:5888409-5888431 ATGCCCACGCGCGGCTGCCCCGG + Intronic
969598009 4:8159647-8159669 CCCACCAGGCGCGGAGGGCCTGG + Intergenic
969716696 4:8871423-8871445 CCGAGCAGGCGCGGCGGCGACGG - Exonic
969726231 4:8920099-8920121 CGGCCCGGGCTCGGTGGCCCAGG - Intergenic
970637052 4:18021447-18021469 GCGGCGCGGCGCGGCGGCCCCGG - Intronic
972274568 4:37545135-37545157 CTGGCCAGGCGCGGTGGCTCAGG - Intronic
972396654 4:38664099-38664121 CCGCCCAGCCCGGGCGGCCGCGG + Intergenic
972543122 4:40056637-40056659 CCGCCTCGGCGCGGCGGCCCGGG - Intergenic
972765726 4:42151466-42151488 AAGCCCAGGCGCGGCGGCGCTGG + Intronic
973373299 4:49270747-49270769 CTGCCCAGGGGCGGCTGCACCGG - Intergenic
973387706 4:49524461-49524483 CTGCCCAGGGGCGGCTGCACCGG + Intergenic
973628627 4:52797594-52797616 GCGGCCAGGCGCGGTGGCTCAGG + Intergenic
973802542 4:54493400-54493422 CTGCCCAGCCTCGGCGGCTCCGG - Intergenic
975041057 4:69744287-69744309 CAGCGGAGGCGCAGCGGCCCTGG + Intronic
975701256 4:77069133-77069155 CTGGCCAGGCGCAGCGGCTCCGG + Intronic
976246750 4:83012655-83012677 CCGCCAAGGCCCACCGGCCCGGG + Intronic
976868140 4:89756057-89756079 CAGGCCAGGCGCGGTGGCTCAGG - Intronic
980075146 4:128287229-128287251 CGTCCCAGGTGCGGCGGCCGAGG + Intronic
980075153 4:128287243-128287265 CGGCCGAGGCGCGGGGGTCCCGG + Intronic
983649843 4:170026682-170026704 CCGCGCTGCCGCGGAGGCCCTGG - Intronic
983940610 4:173531353-173531375 CCACACGGGCGCTGCGGCCCGGG - Intergenic
984167529 4:176320293-176320315 CGGCCCCGGCACGGCAGCCCCGG - Intronic
985512556 5:320916-320938 CCGTCCGGGCGCGCAGGCCCTGG - Intronic
989178778 5:38556384-38556406 CAGCCCCGGGGCGGCGGCCGAGG - Intronic
989354664 5:40529966-40529988 CCGGCCAGGCGCAGTGGCTCAGG + Intergenic
991216909 5:64166029-64166051 CTACCCAGCCGCGGTGGCCCGGG + Intronic
992067403 5:73120508-73120530 CTGCGCGGGCGCGGCGGCCCGGG - Exonic
992530259 5:77645775-77645797 CCGCCCAGCCGAGGCGGAGCGGG - Intergenic
993116147 5:83722202-83722224 CGGCCCCGGCGGGGCGGCGCGGG + Intergenic
994072840 5:95620890-95620912 CCGGCCAGGCGCGGGCGGCCGGG - Exonic
996738415 5:126777524-126777546 CTGCCCATCCGCGGCGGCACGGG - Exonic
997453904 5:134004225-134004247 CCGCCCACGCTCGCCGGACCAGG - Intronic
998371804 5:141666585-141666607 CGGCCCAGCCGCAGCAGCCCGGG + Exonic
999753637 5:154648335-154648357 CCGGCCAGGCACAGTGGCCCAGG - Intergenic
1000071430 5:157744044-157744066 CCGCCCGGACGCGCCCGCCCCGG + Exonic
1000226480 5:159266647-159266669 CAGCACAGGCCCGGAGGCCCAGG + Intronic
1001341993 5:170855517-170855539 TCGGCCAGGCGCGGTGGCTCGGG - Intergenic
1001653279 5:173329845-173329867 CTGCCCAGGCGACGCGGCCCTGG + Intergenic
1002102886 5:176866098-176866120 CCGCCCAGGCCCACTGGCCCGGG + Intronic
1003076774 6:2989193-2989215 CCTCCCAGGCGTGGCGAGCCGGG - Intronic
1004690229 6:17987296-17987318 CCGCCCCGGCCCCCCGGCCCCGG + Intronic
1006419872 6:33926120-33926142 GCGCCCAGGGGCTGGGGCCCAGG - Intergenic
1006491475 6:34392150-34392172 CCGCCCGAGCGGGGCGGCCCTGG + Intronic
1006717576 6:36130391-36130413 AGGCCCGGGCGTGGCGGCCCCGG + Exonic
1006932801 6:37697751-37697773 CCGCCCCCGCCCGGCGGCCTTGG + Exonic
1007095771 6:39212004-39212026 CAGGCCAGGCACGGCGGCTCAGG + Intronic
1007785249 6:44276083-44276105 CGGCCCGGGCGCGGCGGGCGTGG + Exonic
1008605915 6:53139584-53139606 CAGGCCAGGCGCGGTGGCTCAGG + Intronic
1008648953 6:53544568-53544590 CCGACCACGTGCGGCGGCACGGG - Exonic
1009468290 6:64000864-64000886 CTGGCCAGGCGCGGTGGCTCAGG + Intronic
1013135427 6:107277669-107277691 CAGGCCAGGCGCGGTGGCTCAGG + Intronic
1013514848 6:110875763-110875785 CCTCCCACCCGCGGCGGCCGCGG + Intronic
1014798283 6:125749533-125749555 CCGCCCCCGCGCACCGGCCCAGG - Intronic
1015573851 6:134649989-134650011 CAGGCCAGGCGCGGTGGCTCAGG + Intergenic
1015935709 6:138404422-138404444 ACACGCAGGCGGGGCGGCCCGGG + Exonic
1016010655 6:139135150-139135172 CCGCGCGGGCGCCGCGGGCCCGG - Exonic
1016272150 6:142301833-142301855 GGGCTCAGGTGCGGCGGCCCCGG - Intronic
1017671832 6:156777195-156777217 CCGCCGAGCCGCCCCGGCCCCGG + Intergenic
1017962265 6:159232923-159232945 CGGCCCAGACGCTGCGGGCCCGG + Exonic
1019780234 7:2935460-2935482 CTGACCAGGCGCGGTGGCTCAGG - Intronic
1019966917 7:4506914-4506936 CAGGCCAGGCGCGGTGGCTCAGG - Intergenic
1020008071 7:4792673-4792695 CGGCCCCGGCTCAGCGGCCCTGG - Intronic
1020106366 7:5423955-5423977 CGGCCAATGCGCGGCGGCCGGGG - Intronic
1020107635 7:5429465-5429487 CAGCCCTGCCGCGGCGCCCCAGG + Intergenic
1021231055 7:18086736-18086758 CCGCCCAGCCTCCGCGGCGCTGG + Intergenic
1021740620 7:23681687-23681709 CCAGCCGGGCGCGGTGGCCCAGG - Intronic
1022098719 7:27156798-27156820 CCGCCCGCGCCCGGCGGGCCTGG + Intronic
1022207555 7:28179668-28179690 CCGGCCTGGCGCGGACGCCCGGG - Intronic
1023954254 7:44871880-44871902 CCTCCCAGACGGGGCGGCCAGGG + Intergenic
1025783504 7:64622808-64622830 CCAGCCAGGCGCGGTGGCTCAGG + Intergenic
1025992509 7:66506340-66506362 CCGCCGAGGCGGGGCGGGGCGGG - Intergenic
1026858506 7:73770107-73770129 CCCGCCAGGCCCAGCGGCCCCGG - Exonic
1029338038 7:99919139-99919161 CCGCACAGGCCCGGGGGCACGGG + Exonic
1029544342 7:101202387-101202409 CCTCCCCGGCCCGGCAGCCCTGG + Intergenic
1030486409 7:110174344-110174366 CCGGCCGGGCGCGGTGGCTCAGG + Intergenic
1030614862 7:111728790-111728812 ACGCCCCGACGCGGAGGCCCCGG + Intronic
1034268022 7:149790537-149790559 CCGGCCATGCGCGGCCCCCCTGG + Intergenic
1035427913 7:158794210-158794232 ACGCCCAGGCGTGGCCGCTCAGG + Intronic
1035664849 8:1373332-1373354 CGGTCCAGGCGCGGCGCCTCCGG - Intergenic
1036393828 8:8349561-8349583 CCGGCCGGGCGCGGTGGCTCAGG - Intronic
1036432237 8:8702071-8702093 GCGCCCAGGGGCGGCTGCCGCGG - Exonic
1040721859 8:50334176-50334198 CTGGCCAGGCGCGGTGGCTCAGG - Intronic
1042279203 8:67037003-67037025 CTGGCCAGGCGCGGTGGCTCAGG + Intronic
1044430728 8:92103411-92103433 CCGACCGGCCGCGGCGCCCCTGG - Intergenic
1045098981 8:98825979-98826001 CCGCCCACCCGCCGCGGCACCGG - Intronic
1045510716 8:102810442-102810464 CGGCCCGGGCGCGGCGGGACAGG + Intergenic
1048258868 8:132928050-132928072 TCGGCCAGGCGCGGTGGCTCAGG - Intronic
1049693716 8:143973623-143973645 CTGCCCGGCCGCGGCGGCCCCGG - Intronic
1049845487 8:144798915-144798937 CCGCGCTGTCTCGGCGGCCCAGG + Exonic
1057099233 9:92341683-92341705 CTGCCCTGGGGCGGCTGCCCAGG - Intronic
1057146776 9:92764219-92764241 CCGCCCCGCCGGGGCCGCCCAGG + Intronic
1057488560 9:95505894-95505916 CCTCCCCAGCGCGGCGGCCGCGG + Intronic
1057716697 9:97501644-97501666 CCGCCCGCCCGCGGCCGCCCGGG + Exonic
1057797501 9:98169360-98169382 CCGCCCAGGGACGGTGGCTCTGG - Intronic
1058058778 9:100474009-100474031 CCGCTCAGCCTCGCCGGCCCCGG - Intronic
1059020858 9:110575024-110575046 TCGGCCAGGCGCGGTGGCTCAGG - Intronic
1059414753 9:114155858-114155880 CCGGCCTGGCGCGGCGGGGCGGG + Exonic
1059633933 9:116154328-116154350 GCGGCGAGGCGCGGCGGCCGCGG - Exonic
1060114379 9:120928924-120928946 CAGCCCAGCCGCGGGCGCCCCGG - Intronic
1060811477 9:126613398-126613420 CCGAGCAGGCGCCGCCGCCCGGG + Intergenic
1061080999 9:128370237-128370259 CAGGCCGGGCGCGGCGGCTCAGG - Intergenic
1061559541 9:131393946-131393968 CCTCCCGGGAGCGGCGGCCTTGG - Intergenic
1061700329 9:132410543-132410565 GCGCCCTGGCCCCGCGGCCCGGG + Intronic
1062059696 9:134488465-134488487 CCGAGCAGGGGCGGCTGCCCTGG - Intergenic
1062392322 9:136338768-136338790 CGGCCCAGGCGAGGTGGCCTGGG + Intronic
1062406746 9:136400298-136400320 CTGCCCTCGCGCGGCCGCCCTGG + Intergenic
1203470366 Un_GL000220v1:113187-113209 CCGCTCCGGCGGGGCGGCGCGGG + Intergenic
1203478187 Un_GL000220v1:157159-157181 CCGCTCCGGCGGGGCGGCGCGGG + Intergenic
1203552201 Un_KI270743v1:172279-172301 CTGCCCAGGGGCGGCTGCACCGG + Intergenic
1187042514 X:15611878-15611900 AGGCCCAGGCGCGGTGGCTCAGG + Intergenic
1187698205 X:21941219-21941241 CCGCCCGCGCCCGGCAGCCCGGG - Intronic
1189104311 X:38220695-38220717 CCGCCCAGCCGCAGCTTCCCAGG - Exonic
1190033637 X:46998976-46998998 TCGGCCAGGCGCGGTGGCTCAGG - Intronic
1193174614 X:78377920-78377942 CCGTCCAGGCGCGGTGACTCAGG - Intergenic
1194860701 X:98994958-98994980 CTGGCCAGGCGCGGTGGCTCAGG - Intergenic
1195681206 X:107547905-107547927 CCTGCCAGGCCCAGCGGCCCCGG - Intronic
1196001985 X:110795955-110795977 AGGCGCGGGCGCGGCGGCCCGGG + Intergenic
1197754472 X:129984231-129984253 CCGCCCAGAAGCGGCGGCGGCGG - Intronic
1199595855 X:149505265-149505287 CCGCCCGGGCCCGCAGGCCCGGG + Intronic
1199741145 X:150737783-150737805 CTGGCCAGGCGCGGTGGCTCAGG + Intronic
1199881172 X:151974947-151974969 CCGCCCAGGCCCCGCGCCGCGGG - Intergenic
1200155577 X:153972930-153972952 CCGCCCGGGCGCGGCGGCGGCGG + Intronic
1200161577 X:154012514-154012536 CCTCCCAGGTGCTGCCGCCCAGG - Exonic
1202098354 Y:21278139-21278161 CTGGCCAGGCGCGGTGGCTCAGG - Intergenic