ID: 1160681232

View in Genome Browser
Species Human (GRCh38)
Location 19:412486-412508
Sequence AATCCAAGGCTGCCCCACAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160681214_1160681232 27 Left 1160681214 19:412436-412458 CCCAGGTGGGGGCCCCACCAGGG No data
Right 1160681232 19:412486-412508 AATCCAAGGCTGCCCCACAGTGG No data
1160681228_1160681232 -8 Left 1160681228 19:412471-412493 CCAGAGCCAGGCCTGAATCCAAG No data
Right 1160681232 19:412486-412508 AATCCAAGGCTGCCCCACAGTGG No data
1160681221_1160681232 14 Left 1160681221 19:412449-412471 CCCACCAGGGACCCGGGGCTTCC No data
Right 1160681232 19:412486-412508 AATCCAAGGCTGCCCCACAGTGG No data
1160681222_1160681232 13 Left 1160681222 19:412450-412472 CCACCAGGGACCCGGGGCTTCCC No data
Right 1160681232 19:412486-412508 AATCCAAGGCTGCCCCACAGTGG No data
1160681216_1160681232 26 Left 1160681216 19:412437-412459 CCAGGTGGGGGCCCCACCAGGGA No data
Right 1160681232 19:412486-412508 AATCCAAGGCTGCCCCACAGTGG No data
1160681220_1160681232 15 Left 1160681220 19:412448-412470 CCCCACCAGGGACCCGGGGCTTC No data
Right 1160681232 19:412486-412508 AATCCAAGGCTGCCCCACAGTGG No data
1160681227_1160681232 -7 Left 1160681227 19:412470-412492 CCCAGAGCCAGGCCTGAATCCAA No data
Right 1160681232 19:412486-412508 AATCCAAGGCTGCCCCACAGTGG No data
1160681225_1160681232 3 Left 1160681225 19:412460-412482 CCCGGGGCTTCCCAGAGCCAGGC No data
Right 1160681232 19:412486-412508 AATCCAAGGCTGCCCCACAGTGG No data
1160681210_1160681232 30 Left 1160681210 19:412433-412455 CCCCCCAGGTGGGGGCCCCACCA No data
Right 1160681232 19:412486-412508 AATCCAAGGCTGCCCCACAGTGG No data
1160681226_1160681232 2 Left 1160681226 19:412461-412483 CCGGGGCTTCCCAGAGCCAGGCC No data
Right 1160681232 19:412486-412508 AATCCAAGGCTGCCCCACAGTGG No data
1160681212_1160681232 28 Left 1160681212 19:412435-412457 CCCCAGGTGGGGGCCCCACCAGG No data
Right 1160681232 19:412486-412508 AATCCAAGGCTGCCCCACAGTGG No data
1160681211_1160681232 29 Left 1160681211 19:412434-412456 CCCCCAGGTGGGGGCCCCACCAG No data
Right 1160681232 19:412486-412508 AATCCAAGGCTGCCCCACAGTGG No data
1160681223_1160681232 10 Left 1160681223 19:412453-412475 CCAGGGACCCGGGGCTTCCCAGA No data
Right 1160681232 19:412486-412508 AATCCAAGGCTGCCCCACAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160681232 Original CRISPR AATCCAAGGCTGCCCCACAG TGG Intergenic
No off target data available for this crispr