ID: 1160681424

View in Genome Browser
Species Human (GRCh38)
Location 19:413226-413248
Sequence GTGGAGGGGCCAGGATGCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160681424_1160681435 5 Left 1160681424 19:413226-413248 CCGGGGCATCCTGGCCCCTCCAC No data
Right 1160681435 19:413254-413276 CAGCTGATTCCCGGGGATCCTGG No data
1160681424_1160681438 15 Left 1160681424 19:413226-413248 CCGGGGCATCCTGGCCCCTCCAC No data
Right 1160681438 19:413264-413286 CCGGGGATCCTGGCCCTCTATGG No data
1160681424_1160681431 -4 Left 1160681424 19:413226-413248 CCGGGGCATCCTGGCCCCTCCAC No data
Right 1160681431 19:413245-413267 CCACGGCACCAGCTGATTCCCGG No data
1160681424_1160681439 21 Left 1160681424 19:413226-413248 CCGGGGCATCCTGGCCCCTCCAC No data
Right 1160681439 19:413270-413292 ATCCTGGCCCTCTATGGCACCGG No data
1160681424_1160681433 -2 Left 1160681424 19:413226-413248 CCGGGGCATCCTGGCCCCTCCAC No data
Right 1160681433 19:413247-413269 ACGGCACCAGCTGATTCCCGGGG No data
1160681424_1160681432 -3 Left 1160681424 19:413226-413248 CCGGGGCATCCTGGCCCCTCCAC No data
Right 1160681432 19:413246-413268 CACGGCACCAGCTGATTCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160681424 Original CRISPR GTGGAGGGGCCAGGATGCCC CGG (reversed) Intergenic
No off target data available for this crispr