ID: 1160682081

View in Genome Browser
Species Human (GRCh38)
Location 19:416547-416569
Sequence TCTGGGGGCCCTCGCGGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 298
Summary {0: 1, 1: 0, 2: 3, 3: 34, 4: 260}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160682081_1160682092 4 Left 1160682081 19:416547-416569 CCAGCCCCGCGAGGGCCCCCAGA 0: 1
1: 0
2: 3
3: 34
4: 260
Right 1160682092 19:416574-416596 CAGGTGGGCTTGTGCTCTTGTGG 0: 1
1: 0
2: 1
3: 13
4: 173
1160682081_1160682093 15 Left 1160682081 19:416547-416569 CCAGCCCCGCGAGGGCCCCCAGA 0: 1
1: 0
2: 3
3: 34
4: 260
Right 1160682093 19:416585-416607 GTGCTCTTGTGGCCATTCCCAGG 0: 1
1: 0
2: 2
3: 17
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160682081 Original CRISPR TCTGGGGGCCCTCGCGGGGC TGG (reversed) Intergenic
900244921 1:1632335-1632357 GCTGGGGGCCCCGGCGGTGCCGG + Exonic
900376002 1:2355078-2355100 GCGGGGGGCCCGCGCGGGGTAGG + Intronic
900411498 1:2514666-2514688 TATGGGGGGCTTCCCGGGGCAGG + Intronic
900504075 1:3020502-3020524 TCTGGGGGGCCAAGCTGGGCTGG + Intergenic
900590686 1:3458193-3458215 TCTGTGAGCCCTTGCGGGGCAGG - Intronic
900635069 1:3659228-3659250 CCTGGGGGCCGTGGCGGGGCAGG + Intronic
900754428 1:4423908-4423930 TCTGGGGGCCCATGAGGAGCTGG - Intergenic
901068732 1:6506824-6506846 TCTGGGCTCCCTTTCGGGGCTGG + Intronic
901271371 1:7954361-7954383 TCTGGTGGCCCACGCTGGGGGGG + Intronic
902067613 1:13700660-13700682 CCTGGGGCCCCACGTGGGGCCGG + Intronic
902214117 1:14924033-14924055 TCTGGGCGCCGCGGCGGGGCGGG + Intronic
902870860 1:19312670-19312692 GCGAGGGGCCCTCGCGGCGCTGG + Exonic
903384224 1:22916239-22916261 TCTGGGGCCCCACATGGGGCTGG + Intergenic
903603695 1:24559676-24559698 TGTGGGGGCCCTTGCGGGGCTGG + Intronic
903986607 1:27233953-27233975 TCTGGGTGCCCTCGGGGTGATGG - Intergenic
905199522 1:36306679-36306701 GCTGGGTGCCCGCGCGGGGCTGG + Exonic
905912119 1:41662288-41662310 GCTGGCGGCCCACGCGGCGCGGG + Intronic
906805412 1:48775809-48775831 TCTCAGGGCCCTGGCAGGGCAGG + Intronic
907246947 1:53114690-53114712 TCTGGGGGACCTGGCAGGGCAGG + Intronic
908247349 1:62238297-62238319 TCTGAGAGCCCACGCGGAGCAGG - Exonic
911266760 1:95753077-95753099 TCTGGGGGACTTCCAGGGGCAGG - Intergenic
913996489 1:143654922-143654944 TCTGGAGGTCCTCCCGTGGCTGG + Intergenic
914224835 1:145711880-145711902 TTTGGGGGCCCTTGAGGGTCTGG - Intergenic
917441983 1:175076368-175076390 TCTTGGGGCCCTCCTGTGGCAGG - Intronic
921155100 1:212433052-212433074 ACTGGGGGCCCCCGCTCGGCAGG - Exonic
922250597 1:223845866-223845888 TCAGGGGGCCCGGCCGGGGCGGG - Exonic
922757818 1:228106254-228106276 TCTGGGGACCCTCCCAGGGCAGG + Intergenic
922920362 1:229296659-229296681 TCTGGGGGCCCTTTCTGGGTAGG + Intronic
923109170 1:230877284-230877306 GCTGAGGGCCCACGCAGGGCAGG - Intergenic
1065925918 10:30433926-30433948 TCTGGGCGCCCGGGCGGAGCTGG - Exonic
1067088021 10:43253076-43253098 CCTGTGGGCCCTCCCTGGGCTGG - Intronic
1067249545 10:44575351-44575373 TCTGGGGACCCTCCTGGGTCTGG + Intergenic
1067343838 10:45424159-45424181 TCTGGGGGCCCAAGTGGTGCTGG + Intronic
1069622449 10:69846263-69846285 TCTGGTGGCACTGGAGGGGCTGG + Intronic
1070020151 10:72577168-72577190 TCTGGGGGCTCTGGGGGGACAGG + Intronic
1070162236 10:73873722-73873744 TCTGGGGGGGCGGGCGGGGCGGG + Intronic
1070172109 10:73940770-73940792 TCTGGCGGCCCCTGCTGGGCTGG + Intergenic
1073177751 10:101566715-101566737 GCTGGGCTCCCTCCCGGGGCGGG - Intergenic
1073206150 10:101770484-101770506 TCTTGGAGCCCTTGCGGGGCCGG + Exonic
1076554821 10:131314342-131314364 TCTGGGGGCACTCACAGGGAGGG - Intergenic
1077221945 11:1421833-1421855 TCAGAGGCCCCTCTCGGGGCAGG + Intronic
1077500573 11:2908154-2908176 TCTGGGGTCCCTGGATGGGCAGG - Intronic
1077578881 11:3404443-3404465 TCTGGGGGCTGTGGCAGGGCAGG + Intergenic
1077578895 11:3404492-3404514 TCTGGGGGCTGTGGCAGGGCAGG + Intergenic
1078091776 11:8268538-8268560 ACTCGGCGCCCGCGCGGGGCCGG - Intronic
1078097728 11:8310953-8310975 GCTGGGGGCCCAGGAGGGGCAGG - Intergenic
1078180069 11:9003997-9004019 GCTCGGGGCCCTTGCGGCGCTGG - Exonic
1079353723 11:19713779-19713801 GCTGGGGGCCCGCCCGGGCCGGG - Exonic
1083172295 11:60930247-60930269 TTTGGGGGCCCTCCAGGGTCTGG - Intronic
1083669468 11:64292044-64292066 TCTGGGTGCCCTGGCGCGGCCGG + Intronic
1084088040 11:66863718-66863740 TCAGGGGGCCCTCCAAGGGCCGG + Intronic
1084148044 11:67275402-67275424 CCTGGAAGCCCTCACGGGGCTGG + Intronic
1084235917 11:67788011-67788033 TCTGGGGGCTGTGGCAGGGCAGG + Intergenic
1085345828 11:75767729-75767751 GCTGGGGGCCCTGGAGTGGCTGG - Intronic
1085477243 11:76796279-76796301 TCCGGGTGCCTTCGCGGGGCTGG + Exonic
1088315025 11:108498441-108498463 ACTGGGGCCCACCGCGGGGCGGG + Intergenic
1088604284 11:111513126-111513148 GCAGCGGGCGCTCGCGGGGCAGG - Intergenic
1090187011 11:124745659-124745681 CCTGGGGGGCCTGGCGGAGCTGG + Exonic
1090267066 11:125359797-125359819 TAAGGGGGCCCTCCTGGGGCTGG + Intronic
1090658131 11:128861319-128861341 ATTGGGGGCCCTAGTGGGGCTGG + Intronic
1091732356 12:2890660-2890682 TCTGGAGCGCCTCGCGGGGCCGG - Intronic
1091836453 12:3589523-3589545 TCTGGGGGGCGTGGAGGGGCAGG - Intronic
1091888190 12:4031708-4031730 TCTGGGCGGCCCCGAGGGGCTGG + Intergenic
1092406808 12:8227324-8227346 TCTGGGGGCTGTGGCAGGGCAGG + Intronic
1095060965 12:37687592-37687614 TCTGGGGACCCTTGTGGGGTGGG + Intergenic
1096156744 12:49345421-49345443 TCTGGCCGCTCCCGCGGGGCCGG + Intergenic
1096229800 12:49890556-49890578 TGTGAGGTCCCTGGCGGGGCAGG - Intronic
1096260140 12:50085296-50085318 TCGGGGGGCGCTCGGGGGGCGGG + Exonic
1096472438 12:51888115-51888137 ACTGGGGCCCCATGCGGGGCGGG - Exonic
1098024734 12:66189510-66189532 GCTGGGGTCCCTCGCGGGGCTGG + Intronic
1098521698 12:71440426-71440448 TCTGGGGGCCCTAACAGGCCTGG - Intronic
1100403384 12:94251566-94251588 CCTGGGGCCTCTCGCCGGGCAGG + Intronic
1102951870 12:117036596-117036618 TGTGGGAGCCCTCGGGGAGCAGG + Intergenic
1102957911 12:117071432-117071454 GCTGTGGGCCTTCACGGGGCAGG + Intronic
1104281384 12:127381194-127381216 TCTGGGAGCCTCCGCGGGGAGGG + Intergenic
1105621518 13:22071996-22072018 TGTAGGGGCCCTGGAGGGGCTGG + Intergenic
1107771521 13:43792294-43792316 TCTGGGGCCCATCGGGAGGCAGG - Intergenic
1107877488 13:44803634-44803656 TGTGGGGGCCCTCCCAGGGCTGG - Intergenic
1107964319 13:45585867-45585889 AATGGGGCCCCTCTCGGGGCTGG + Intronic
1113332611 13:109344932-109344954 TCTGGGGACGCTCTCAGGGCCGG + Intergenic
1113890219 13:113731640-113731662 TCTGAGGGCCCTGTGGGGGCCGG + Intronic
1113893536 13:113749014-113749036 TCTGTGGGCGCCCACGGGGCAGG + Intergenic
1113909261 13:113834490-113834512 TCCGGGGGCCCTCGCCGGTGGGG - Intronic
1113939548 13:114011239-114011261 TCTGGGGGTCCTGGGGAGGCGGG + Exonic
1113962046 13:114131668-114131690 GCTGAGGGCTCCCGCGGGGCGGG - Intronic
1117119480 14:52552740-52552762 TCTCGGGGCCCTCGAGCGACGGG + Intergenic
1118887576 14:69879573-69879595 GCTCGGGGCCCTCGCGGCGGCGG - Exonic
1121341570 14:93108125-93108147 TCTGGTGGCCCTTGGGGAGCCGG - Intronic
1121562459 14:94885449-94885471 TCTGTGGGCCCTTGGAGGGCCGG - Intergenic
1122145074 14:99684164-99684186 TCTGGGGGGCGGGGCGGGGCGGG + Intergenic
1122230989 14:100306275-100306297 CCTGAGGCCCCTCGCCGGGCTGG + Exonic
1122296742 14:100710022-100710044 TCGGGGAGGCTTCGCGGGGCTGG - Intergenic
1122538884 14:102485650-102485672 ACTGGGGGCACACGCAGGGCAGG - Intronic
1122788321 14:104174018-104174040 CCTGGGGCCCCACGCTGGGCTGG + Intronic
1122975316 14:105168503-105168525 TCTGCGGGCGCTCGGAGGGCGGG - Exonic
1202856317 14_GL000225v1_random:53834-53856 CCTGGAGGCCCCCGCGTGGCAGG + Intergenic
1128078318 15:64841828-64841850 TCCGGGGGCCGGGGCGGGGCCGG - Intergenic
1128344072 15:66842671-66842693 TCTGGGGGCCCGGGGCGGGCGGG + Intergenic
1128753478 15:70165346-70165368 CCTGGGTGCAGTCGCGGGGCGGG + Intergenic
1129239951 15:74245280-74245302 AGTGGGGGCCCTGGGGGGGCAGG - Intronic
1129376616 15:75137693-75137715 ACTGGGGACCCTAGTGGGGCAGG + Intergenic
1129387006 15:75201862-75201884 TCTGCGGTCCCGGGCGGGGCGGG - Intronic
1129406487 15:75322579-75322601 TCTGACGGCCCTCGCTGTGCAGG - Intergenic
1129674934 15:77627397-77627419 TCTGGAGGGCCTCGCGGGTCGGG + Intronic
1129675911 15:77632445-77632467 TCCGCGCGCCCTCGCGGGGCTGG + Exonic
1131175825 15:90209090-90209112 TCTGGGGCCCCTCTCTGGGCTGG + Intronic
1132482286 16:172697-172719 CCTGGGGGTGCACGCGGGGCGGG - Intergenic
1132483134 16:176501-176523 CCTGGGGGTGCACGCGGGGCGGG - Intergenic
1132546487 16:535647-535669 TCTGGGCTCCCTGGAGGGGCAGG - Intronic
1132750988 16:1457628-1457650 CGTGGCGGCCCTCGCGGGCCCGG + Intronic
1132806864 16:1778950-1778972 CCTGGGGGCCCCTGCAGGGCTGG - Intronic
1136116701 16:28099154-28099176 TCGGGTGGCTCTCGAGGGGCAGG - Intronic
1136623008 16:31442703-31442725 TCGGGGGCGGCTCGCGGGGCAGG - Exonic
1137603603 16:49772749-49772771 TCTGTGGCCCCTTGTGGGGCAGG - Intronic
1139429522 16:66903758-66903780 TCTGGGGGCCTGGGCGGGGCAGG - Intergenic
1139597606 16:67967577-67967599 TCTGGGGGGCCTCCTGGGGTAGG + Intronic
1141811714 16:86380365-86380387 ACTGGGGGCCCTCCGGGGGTGGG + Intergenic
1142240378 16:88941923-88941945 GCTGGGGGCGAGCGCGGGGCAGG - Intronic
1142406428 16:89892818-89892840 TGTGGGGGCCCTCAGGGGCCAGG + Intronic
1142590939 17:1005758-1005780 TCTGTGTGCCCACGCCGGGCCGG + Exonic
1142852735 17:2711950-2711972 GCTGGGCGCCCTCGCGGGGCGGG + Exonic
1142957672 17:3532462-3532484 TCTGAGGGGCCACGCGGAGCTGG - Intronic
1145413524 17:22694479-22694501 TGTGGGGGCCCGGGCGGGGAGGG - Intergenic
1146179381 17:30687548-30687570 TGTGGGGGCAGGCGCGGGGCGGG - Intergenic
1146255870 17:31391473-31391495 TGGGGCGGCCCACGCGGGGCCGG - Intergenic
1146649869 17:34599962-34599984 GCTGGGGGCCCTGGTGGGGAGGG + Intronic
1146843285 17:36168990-36169012 GCTGGGGCCCCTCGTGGGGCTGG - Intronic
1146855595 17:36256931-36256953 GCTGGAGCCCCTCGTGGGGCTGG - Intronic
1146865026 17:36331444-36331466 GCTGGAGCCCCTCGTGGGGCTGG + Intronic
1146871501 17:36380842-36380864 GCTGGAGCCCCTCGTGGGGCTGG - Intronic
1146878860 17:36431924-36431946 GCTGGAGCCCCTCGTGGGGCTGG - Intronic
1146882802 17:36453070-36453092 GCTGGAGCCCCTCGTGGGGCTGG - Intergenic
1146957190 17:36942609-36942631 GCGGGGAGCCCTCGCGGGCCTGG - Intronic
1147067885 17:37932038-37932060 GCTGGAGCCCCTCGTGGGGCTGG + Intronic
1147074387 17:37981466-37981488 GCTGGAGCCCCTCGTGGGGCTGG - Intronic
1147079416 17:38011593-38011615 GCTGGAGCCCCTCGTGGGGCTGG + Intronic
1147085910 17:38061005-38061027 GCTGGAGCCCCTCGTGGGGCTGG - Intronic
1147095356 17:38135535-38135557 GCTGGAGCCCCTCGTGGGGCTGG + Intergenic
1147101856 17:38184970-38184992 GCTGGAGCCCCTCGTGGGGCTGG - Intergenic
1147536526 17:41325862-41325884 GCTGGAGCCCCTCGTGGGGCTGG + Intergenic
1147671137 17:42177593-42177615 TCTGGGGGCCCAGTGGGGGCTGG + Intronic
1148328248 17:46796602-46796624 GCTGGGAGCCCCTGCGGGGCAGG - Intronic
1149660329 17:58331415-58331437 TCGGGGGGCCCTGGCAGGGTTGG - Intergenic
1149846449 17:60011480-60011502 GCTGGAGCCCCTCGTGGGGCTGG - Intergenic
1149915097 17:60600949-60600971 GCCGGGGGCCCACGCGGGGCTGG - Intronic
1150084797 17:62268055-62268077 GCTGGAGCCCCTCGTGGGGCTGG - Intergenic
1151366905 17:73623489-73623511 TCTGGGGGCCTTCAGGGGGAAGG - Intronic
1151569108 17:74917338-74917360 TCTGGGGTCCCTGGGGGGCCAGG + Exonic
1151768700 17:76145801-76145823 TGTGGGGGCCCAGGCGGGGCAGG + Intronic
1152175057 17:78782031-78782053 GCGCGGGGCCCTCGCGGGGCGGG - Intronic
1152289011 17:79428299-79428321 CATGGGGGAGCTCGCGGGGCAGG + Intronic
1152322365 17:79614901-79614923 TCTGGGGGCCCTATGGGGGTCGG - Intergenic
1152572814 17:81127986-81128008 CCTGGGGGCCGGCGTGGGGCGGG - Intronic
1152923164 17:83075989-83076011 CCTTGGGGCCCTCATGGGGCTGG - Intergenic
1155519804 18:26656795-26656817 TCTGGGCGCCCCCGCGGCGCTGG + Intronic
1157529323 18:48408760-48408782 CCTGCGGGCCCGAGCGGGGCGGG - Intronic
1160682081 19:416547-416569 TCTGGGGGCCCTCGCGGGGCTGG - Intergenic
1160716635 19:579780-579802 TCTGGGGGTCTGCGCGGAGCTGG - Intronic
1160807059 19:996571-996593 TCTGTGGGGCCTCCGGGGGCGGG - Intronic
1160919497 19:1513127-1513149 CCCGGGCGCCCTCGCGCGGCGGG + Exonic
1161851500 19:6740077-6740099 TTTGGGCGCCCTGGCCGGGCAGG + Intronic
1162302863 19:9854138-9854160 CCTGGGGGGCCTCTGGGGGCTGG - Exonic
1163156001 19:15440255-15440277 TCTGGAGGACCTGGAGGGGCTGG - Intronic
1163252422 19:16133973-16133995 TCTAGGGGCCCTCTCCTGGCTGG + Exonic
1163521785 19:17795833-17795855 ACTGGGGGCCCTTGCGTGACTGG + Intronic
1163757659 19:19116115-19116137 GCTGTGGGCCTTAGCGGGGCAGG - Intergenic
1163807091 19:19405942-19405964 TCCGGGGTCGCCCGCGGGGCCGG - Intronic
1164120526 19:22261705-22261727 GCTGGGGGCCCAGGCAGGGCGGG - Intergenic
1164137743 19:22428655-22428677 GCTGGGGGCCCCGGCAGGGCGGG + Intronic
1165100920 19:33438314-33438336 TCTGGGGCCCCCTGCAGGGCAGG - Intronic
1165316539 19:35059805-35059827 ACTGGGGGCCCTCGGAGGGGTGG + Intronic
1165854332 19:38870707-38870729 TCTGGGGGTCCCCACGGGTCTGG - Exonic
1168111061 19:54191469-54191491 TCTGGCGGGGCCCGCGGGGCAGG - Exonic
1168253408 19:55154206-55154228 TCTGGGGGCACACGAGGGGGTGG + Exonic
1168639994 19:58024809-58024831 TCAGGAGGCCCCAGCGGGGCGGG + Intergenic
927318899 2:21720057-21720079 TCAGGGTGCCCTTGAGGGGCAGG - Intergenic
929075640 2:38076869-38076891 CCTGGGGGAGCTAGCGGGGCGGG + Intronic
931670840 2:64645267-64645289 CCTGCGGGCCCCCGCGCGGCCGG - Intronic
933764090 2:85695402-85695424 CCTGGGGGCCCTCCTGGGCCAGG - Exonic
933772814 2:85754694-85754716 TCCGGGGGCGCTGGCGGTGCTGG - Exonic
934655638 2:96115660-96115682 ACTGGGGGCGCCCGCGCGGCTGG + Exonic
934655826 2:96116468-96116490 TCTGGGGGCGCGGGCCGGGCTGG + Intergenic
937261198 2:120587572-120587594 TCGCGGGCCCCACGCGGGGCGGG + Intergenic
937326149 2:120990420-120990442 TCTGGGGGGCCTCCAGGAGCTGG - Exonic
937354232 2:121187965-121187987 TCTGGGGGCCCAGGCAGGGCGGG + Intergenic
937984422 2:127632188-127632210 TCAGGGGGCCCTGGCCAGGCAGG - Intronic
940947767 2:159637286-159637308 TCTGGAGCCCCTCCCAGGGCAGG - Intergenic
942459761 2:176160724-176160746 TCTGGGGGGCCTGGGAGGGCTGG + Intronic
947593021 2:231395824-231395846 GCTGGGGGCCGTCGGGGGCCTGG + Intronic
947623465 2:231605014-231605036 GCTGCGGGCCCGGGCGGGGCGGG + Intergenic
947919007 2:233853943-233853965 TCTGGGGCCCCTCGTGGCCCTGG - Intronic
948461279 2:238131072-238131094 GCCGGGGGCCCTCGCTGGGCGGG - Exonic
948994641 2:241572222-241572244 GCTGGGGGGCCTGGCGGTGCTGG + Intronic
1171266585 20:23776375-23776397 TATGGGGGGCCGGGCGGGGCGGG - Intergenic
1172042015 20:32052517-32052539 CCTGGGACCCCTCGCGGGCCGGG - Intronic
1172056037 20:32155030-32155052 TCTGGGGGCCCCACCGGGACAGG + Intronic
1172629908 20:36371126-36371148 GCTGGGGTCCCTGGCAGGGCAGG + Intronic
1175699000 20:61123818-61123840 ACTGGGGGCCCTCGTGGCCCAGG + Intergenic
1177669708 21:24209096-24209118 TGTGGGGCCCCTCTCTGGGCTGG - Intergenic
1179495763 21:41770359-41770381 TCTGGGAGCCCTCGCGAGTCAGG - Intergenic
1180180530 21:46116863-46116885 TCTGGGGGCCCTGCAGAGGCTGG - Intronic
1181026822 22:20131725-20131747 GCTGGGGGCCGCGGCGGGGCGGG - Intronic
1181031383 22:20150199-20150221 GCTGGGGGCCCTCCTGGGGCCGG - Exonic
1181511950 22:23393203-23393225 GCTGGGGGCCCTCCTGGGGCCGG + Intergenic
1182711370 22:32325346-32325368 TCTTGGGGCCCTGGCCGGGGTGG + Intergenic
1184330103 22:43821804-43821826 TCTGAGGGCCCTGGCTGGGGTGG + Intergenic
1184687768 22:46104234-46104256 TCTGGGGCCGTGCGCGGGGCGGG + Intronic
950439329 3:12999541-12999563 ACTGGGCGCCCACGTGGGGCGGG + Intronic
952946964 3:38484430-38484452 TCTGGGGTCCCCAGCGAGGCAGG - Exonic
953814113 3:46140039-46140061 TCTGGGGACCGTTGCGGGGTGGG - Intergenic
956604953 3:71064865-71064887 TCGGGGCGCCCGCGCGGGCCGGG + Intronic
957051869 3:75417760-75417782 TCTGGGGGCTGTGGCAGGGCAGG + Intergenic
961885477 3:130093992-130094014 TCTGGGGGCTGTGGCAGGGCAGG + Intronic
964451524 3:156817127-156817149 TCAGGCGGCCGTCGCCGGGCGGG + Intergenic
965735068 3:171810617-171810639 GCTGGAGGCCCCAGCGGGGCAGG + Intronic
968089983 3:195893639-195893661 TCTGGGGGCCGTAGCGAGGGGGG - Intronic
968093013 3:195909692-195909714 TGCGGGGGCCGGCGCGGGGCGGG - Intronic
968415814 4:432764-432786 GCTGGAGGACCTCGGGGGGCGGG - Intronic
968433987 4:575780-575802 TTTGGGGGTCCCCGCGGCGCCGG - Intergenic
968683468 4:1938565-1938587 TCTGGGTGCCCAGGCTGGGCTGG + Intronic
968818274 4:2832864-2832886 TCCTGTGGCCCTCGGGGGGCGGG - Intronic
968890944 4:3368118-3368140 TCTGGGGGCCCTGGGGGGCCAGG + Intronic
968947166 4:3671100-3671122 TCTGGGGCCCGGCCCGGGGCAGG + Intergenic
971119841 4:23691043-23691065 TCTGGAGGCCCTGACGGGGCTGG + Intergenic
971289505 4:25323899-25323921 TCTGGGGACCCTAGGGGTGCAGG - Intronic
975680161 4:76868164-76868186 TCTGGGGGCTCTTGAGGGGTAGG + Intergenic
977693925 4:99946765-99946787 CCTAGGGGCCCGCGGGGGGCGGG - Intergenic
979311956 4:119213114-119213136 GCTGGAGGCGCTCGCGAGGCGGG + Intronic
979540342 4:121873776-121873798 TCTGTGGGGCCCCGAGGGGCAGG - Intergenic
985540640 5:485883-485905 TCTTGGGGCCTTCTCGGAGCTGG + Intronic
985541361 5:489042-489064 TCTGGTGCCCCTCGCTGGGGAGG + Intronic
986177547 5:5364966-5364988 GCTGGGAGCTCTCGCAGGGCAGG - Intergenic
987003589 5:13686732-13686754 TCTGGTGACCCTCTCTGGGCAGG - Intergenic
990910006 5:60843770-60843792 ACTGGGGTCCCGCGCGGCGCTGG - Intronic
997282338 5:132656751-132656773 ACTGGGGGCCCTCGAGGGGAAGG + Intronic
998406938 5:141879191-141879213 ACTGCGCGGCCTCGCGGGGCAGG - Intronic
999155963 5:149457715-149457737 CCTGGGGGGCCTCACAGGGCTGG + Intergenic
1001384170 5:171324708-171324730 TCTCGGGTCCCTCCCAGGGCGGG - Intergenic
1001602794 5:172939892-172939914 CCTGGGAGCCCTCGGAGGGCGGG + Intronic
1002197729 5:177510236-177510258 TGAGGGGGCCCTGGAGGGGCTGG - Intronic
1002401583 5:178994213-178994235 AAGGGGCGCCCTCGCGGGGCGGG + Intronic
1002691635 5:181054089-181054111 TCTGCGGGCCCAGGCTGGGCTGG - Intronic
1003872462 6:10413407-10413429 TGTGGGCGCCCTCGGCGGGCGGG - Intronic
1007774984 6:44219797-44219819 GCCGGGGGGCCTGGCGGGGCGGG + Intronic
1010943664 6:81949844-81949866 TCTGGAGGCTCTCACGTGGCAGG + Intergenic
1011055338 6:83197922-83197944 GCTGGAGGACCTGGCGGGGCAGG - Exonic
1019048617 6:169166936-169166958 TCTGTGAGCCCTGGCTGGGCTGG - Intergenic
1019300334 7:299910-299932 ACGGGGTGCCCTCACGGGGCAGG - Intergenic
1019366929 7:638106-638128 GCTGGGTGCCCACGCGGGCCTGG - Intronic
1021027337 7:15686047-15686069 TCTGGGGGCCCTCCAGAGTCGGG + Exonic
1023313212 7:38908958-38908980 CCTAGGTGCCCTCCCGGGGCTGG + Intronic
1024940532 7:54759040-54759062 CCGGGCGGCCGTCGCGGGGCGGG - Intronic
1026300709 7:69095649-69095671 TCTGGGGGCCTTTTTGGGGCAGG + Intergenic
1027220837 7:76212945-76212967 TCTGGGTGCCCTCGAGGGCCCGG + Intronic
1029367834 7:100127674-100127696 GCTGGGGGCGCTGGCGGGGCAGG + Exonic
1029409537 7:100399853-100399875 TCTGGGGGCTCTTGAGGGGACGG - Exonic
1029560505 7:101299919-101299941 TCTGGAGGCCCGCGAGGGTCGGG - Intergenic
1032125248 7:129188787-129188809 TCTGGCCTCCCTCGCGGGGCGGG + Intergenic
1032977445 7:137241881-137241903 TCAGGGGGCCTTCGAGGGGAGGG + Intronic
1033223714 7:139544853-139544875 TCTGGGGCCCGGGGCGGGGCTGG - Exonic
1034172344 7:149071976-149071998 TCTGGCGGCCCACACGGGGAGGG - Exonic
1034540793 7:151756668-151756690 GCTGGGAGCCCTGGCGGGGCTGG - Intronic
1035546821 8:487949-487971 GCTGGGACCCCTCTCGGGGCTGG + Intergenic
1035607870 8:940905-940927 TCTGGGGGACATCTCAGGGCTGG - Intergenic
1036767931 8:11560703-11560725 CCTGGGTGCCCCCACGGGGCAGG + Intronic
1037752666 8:21692842-21692864 TCTGGGGACCCGCTGGGGGCTGG - Exonic
1037754005 8:21699922-21699944 TCTGGGGGCCCTGGCCTAGCAGG + Intronic
1037833949 8:22205291-22205313 TCTGGGGGCCCAGGTGAGGCTGG + Intronic
1038894358 8:31764894-31764916 TCTGGGGACCCTTGTGGGGTGGG - Intronic
1039454918 8:37699844-37699866 TCTGGGGGCTCTGCCGGGCCAGG - Exonic
1040567878 8:48582876-48582898 TTTGGGGGCCCTTGTGGGTCTGG + Intergenic
1041543421 8:59012428-59012450 TCTGTGGTCCCTCTCGTGGCAGG - Intronic
1044320026 8:90791516-90791538 ACTTGGGGCCGTCGTGGGGCTGG + Intronic
1044591437 8:93917260-93917282 GCTGGGGGCCGTCGGGGGGCTGG + Intronic
1049217275 8:141413969-141413991 TCTGGTGGGCGTCGTGGGGCTGG + Intronic
1049340416 8:142109383-142109405 TCTGGGGTCTCTAGAGGGGCTGG + Intergenic
1049628239 8:143636271-143636293 CCTGGACGCCCTAGCGGGGCGGG - Intronic
1049641777 8:143719204-143719226 CCTGGGAGCCCTGGCTGGGCAGG - Intronic
1049675704 8:143887978-143888000 TCCTGGGCCCCTCGCAGGGCTGG + Intergenic
1049769304 8:144372513-144372535 CCTGGGGCCCCTCCCGGAGCCGG - Intergenic
1051449457 9:17178811-17178833 TGTGGGAGCCCTTGCTGGGCTGG - Intronic
1055454352 9:76459157-76459179 TCTGGGGGCGGCCCCGGGGCGGG + Intronic
1055985559 9:82054759-82054781 TGTGGGAGCCCTCTCTGGGCTGG - Intergenic
1057024001 9:91722260-91722282 TCTGGGGGCCCTGGAGCAGCAGG - Intronic
1060667857 9:125443684-125443706 GCTGGGGGAGCTGGCGGGGCTGG - Intronic
1061257501 9:129460978-129461000 TCTGGAGCCCCTCGTGGGCCTGG + Intergenic
1062162273 9:135087172-135087194 GCTGGAGGCCCTCGCGAGTCTGG + Intronic
1062284982 9:135768816-135768838 TCTGGTGGTCCTGGCGGGGTGGG - Exonic
1062501549 9:136854100-136854122 GGTGGGGGCCCTCCCGGGGGTGG - Intronic
1062534346 9:137014939-137014961 TCTTGGCGGCCTCGCTGGGCAGG + Exonic
1062566942 9:137167708-137167730 GCTGGGGGCACGCGCGGGGCCGG - Intronic
1185469335 X:373440-373462 AGCGGGGGCCCACGCGGGGCCGG + Intronic
1185621722 X:1454064-1454086 TATGGGGGTCCCCGCGGGCCGGG + Intergenic
1186609282 X:11123462-11123484 ACTGGGGCCCGTCTCGGGGCCGG + Intergenic
1187117361 X:16366043-16366065 TCTGGGGGCCGTTGTGGGGTGGG + Intergenic
1187281321 X:17860588-17860610 TCTGGCGGCCCTGGCGAGCCTGG - Intronic
1189251879 X:39606717-39606739 GCTGGGGGCCATCTCGGGGGAGG - Intergenic
1199772560 X:150983926-150983948 CCTGCGGGCCCGCGCGGCGCCGG - Intronic