ID: 1160683265

View in Genome Browser
Species Human (GRCh38)
Location 19:422277-422299
Sequence CGGCCGGATGAGCCGCCGGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 62
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 57}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160683265_1160683280 25 Left 1160683265 19:422277-422299 CCGCCCGGCGGCTCATCCGGCCG 0: 1
1: 0
2: 0
3: 4
4: 57
Right 1160683280 19:422325-422347 GTTCCTCCGTGGGGGCCACAGGG 0: 1
1: 0
2: 12
3: 22
4: 111
1160683265_1160683281 26 Left 1160683265 19:422277-422299 CCGCCCGGCGGCTCATCCGGCCG 0: 1
1: 0
2: 0
3: 4
4: 57
Right 1160683281 19:422326-422348 TTCCTCCGTGGGGGCCACAGGGG 0: 1
1: 0
2: 0
3: 16
4: 171
1160683265_1160683279 24 Left 1160683265 19:422277-422299 CCGCCCGGCGGCTCATCCGGCCG 0: 1
1: 0
2: 0
3: 4
4: 57
Right 1160683279 19:422324-422346 TGTTCCTCCGTGGGGGCCACAGG 0: 1
1: 0
2: 0
3: 46
4: 162
1160683265_1160683278 17 Left 1160683265 19:422277-422299 CCGCCCGGCGGCTCATCCGGCCG 0: 1
1: 0
2: 0
3: 4
4: 57
Right 1160683278 19:422317-422339 ACGCAGCTGTTCCTCCGTGGGGG 0: 1
1: 0
2: 0
3: 6
4: 77
1160683265_1160683275 14 Left 1160683265 19:422277-422299 CCGCCCGGCGGCTCATCCGGCCG 0: 1
1: 0
2: 0
3: 4
4: 57
Right 1160683275 19:422314-422336 CTGACGCAGCTGTTCCTCCGTGG 0: 1
1: 0
2: 0
3: 5
4: 109
1160683265_1160683276 15 Left 1160683265 19:422277-422299 CCGCCCGGCGGCTCATCCGGCCG 0: 1
1: 0
2: 0
3: 4
4: 57
Right 1160683276 19:422315-422337 TGACGCAGCTGTTCCTCCGTGGG 0: 1
1: 0
2: 0
3: 3
4: 64
1160683265_1160683277 16 Left 1160683265 19:422277-422299 CCGCCCGGCGGCTCATCCGGCCG 0: 1
1: 0
2: 0
3: 4
4: 57
Right 1160683277 19:422316-422338 GACGCAGCTGTTCCTCCGTGGGG 0: 1
1: 0
2: 0
3: 3
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160683265 Original CRISPR CGGCCGGATGAGCCGCCGGG CGG (reversed) Exonic
903855864 1:26337253-26337275 CGTCCGGATGACCCGGAGGGAGG + Exonic
920814353 1:209317435-209317457 TGGCAGGATGAGCAGCCAGGTGG - Intergenic
924052334 1:240091982-240092004 CGGCGGGGGGAGCCGCTGGGAGG - Exonic
1074065465 10:110008558-110008580 CGGCCTGCGGCGCCGCCGGGTGG + Intronic
1077410322 11:2400831-2400853 GGGCCGGCCGAGCCTCCGGGAGG + Intronic
1084169428 11:67393567-67393589 TGGCCGGAGCAGCCGCCTGGTGG + Exonic
1087138162 11:94740649-94740671 CGGCCGGGGGAGCCGCGGGGTGG + Intronic
1093953922 12:25195198-25195220 CGGCCGGAAGAGCCTCCGCGCGG - Exonic
1097222629 12:57460038-57460060 CGGCGGGCTGGGCCGGCGGGAGG + Intergenic
1117602613 14:57390770-57390792 TGGCCGGCTGAGCAGCTGGGCGG + Intronic
1119540899 14:75437756-75437778 CGGCAGGAAGAGCAGCTGGGTGG + Intronic
1122144748 14:99682951-99682973 CGGCCGGGCCAGGCGCCGGGGGG + Intergenic
1123035588 14:105470626-105470648 CGGCCGGCCGAGCTGCCTGGCGG + Exonic
1129850014 15:78788397-78788419 GGGGCGGGTGAGCCGGCGGGAGG + Intronic
1139489517 16:67279068-67279090 CGGCTGAATGAGCCGACGGGAGG - Exonic
1141625514 16:85259217-85259239 CGTGCGGATGGGCAGCCGGGAGG - Intergenic
1143183396 17:4997562-4997584 CCGCGGGAGGAGCCGGCGGGCGG + Intronic
1146197376 17:30824837-30824859 AGGCGGGGTGAGCCGCGGGGCGG - Intergenic
1148334469 17:46832284-46832306 GGGCCGGCTGAGCTGCCCGGAGG + Intronic
1152699720 17:81812954-81812976 CGGGCGGGGGAGCCGGCGGGCGG - Intronic
1160683265 19:422277-422299 CGGCCGGATGAGCCGCCGGGCGG - Exonic
1160706249 19:531607-531629 CGGCCGCAGGGGACGCCGGGAGG - Intergenic
1162145311 19:8609544-8609566 CGGCCAGATGTGCAGCCGGGAGG - Intronic
931671568 2:64653377-64653399 CTGCGGGCTGAGCCGCTGGGGGG - Intronic
937933021 2:127220101-127220123 CGGCCGGGGTCGCCGCCGGGAGG - Intergenic
942314131 2:174682704-174682726 GGGCCGGGGGAGACGCCGGGAGG - Intronic
944154091 2:196593056-196593078 CGGCGGGAAGAGCCGCTGAGGGG - Intronic
1173880287 20:46406587-46406609 AGGCTGGAGGAGCCGCCGAGCGG - Exonic
1174258792 20:49278260-49278282 CCGCCGGCTCCGCCGCCGGGGGG - Intronic
1176547995 21:8209578-8209600 CGGCCGGACGGCCGGCCGGGGGG - Intergenic
1176548975 21:8213452-8213474 CGGCCGGGCGGGCCGCGGGGCGG - Intergenic
1176555888 21:8253789-8253811 CGGCCGGACGGCCGGCCGGGGGG - Intergenic
1176556868 21:8257664-8257686 CGGCCGGGCGGGCCGCGGGGCGG - Intergenic
1176566926 21:8392613-8392635 CGGCCGGACGGCCGGCCGGGGGG - Intergenic
1176567904 21:8396482-8396504 CGGCCGGGCGGGCCGCGGGGCGG - Intergenic
1176574825 21:8436823-8436845 CGGCCGGACGGCCGGCCGGGGGG - Intergenic
1176575808 21:8440701-8440723 CGGCCGGGCGGGCCGCGGGGCGG - Intergenic
1176611440 21:8988120-8988142 CGGCCGGACGGCCGGCCGGGGGG - Intergenic
1184680745 22:46071202-46071224 CGGCGGGAGGGGCCGCGGGGCGG + Intronic
1185277791 22:49957195-49957217 GGGCGGGATGGGCCGGCGGGAGG + Intergenic
1203252874 22_KI270733v1_random:125878-125900 CGGCCGGACGGCCGGCCGGGGGG - Intergenic
1203253859 22_KI270733v1_random:129759-129781 CGGCCGGGCGGGCCGCGGGGCGG - Intergenic
1203260929 22_KI270733v1_random:170960-170982 CGGCCGGACGGCCGGCCGGGGGG - Intergenic
1203261915 22_KI270733v1_random:174838-174860 CGGCCGGGCGGGCCGCGGGGCGG - Intergenic
953326113 3:42013722-42013744 CGGCCGGGTGGGCCCCGGGGCGG - Intergenic
966762160 3:183428266-183428288 CGGCCGGAGGAGCCGGGGCGCGG - Exonic
966883291 3:184361696-184361718 CCTCCGGATGGGCCGGCGGGCGG - Intronic
966886417 3:184380101-184380123 GGGCGGGAGGAGCGGCCGGGAGG - Exonic
972321689 4:37977799-37977821 GGGCCGGAGGAGCCGCCTGCTGG - Intronic
977574068 4:98658676-98658698 CGGGCGGAGGAGCAGCCGGCCGG - Intergenic
990509982 5:56481171-56481193 CGGCCGGAAGAGCCAGCTGGTGG - Intronic
1025014707 7:55429959-55429981 CGGCTGGAGGAGCCACTGGGAGG + Intronic
1034622225 7:152464534-152464556 CCGCGGGGTGAGCCGCTGGGCGG + Intergenic
1048981193 8:139703985-139704007 CGGGCGCATGAGCCGCGCGGGGG + Intergenic
1062290246 9:135791072-135791094 CGGAGGGATGAGCTGCGGGGTGG + Intronic
1062460652 9:136661323-136661345 GGGCAGGATGAGCCCCTGGGTGG + Intronic
1203469276 Un_GL000220v1:109025-109047 CGGCCGGACGGCCGGCCGGGGGG - Intergenic
1203470259 Un_GL000220v1:112903-112925 CGGCCGGGCGGGCCGCGGGGCGG - Intergenic
1203477097 Un_GL000220v1:152997-153019 CGGCCGGACGGCCGGCCGGGGGG - Intergenic
1203478080 Un_GL000220v1:156875-156897 CGGCCGGGCGGGCCGCGGGGCGG - Intergenic
1187518131 X:19990892-19990914 CGGCCGGGTGAGCGGCTCGGGGG - Intergenic
1198767140 X:140091488-140091510 CGGGTGGCTGAGCCGGCGGGCGG + Intergenic