ID: 1160683266

View in Genome Browser
Species Human (GRCh38)
Location 19:422280-422302
Sequence CCACGGCCGGATGAGCCGCC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 77}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160683266_1160683284 28 Left 1160683266 19:422280-422302 CCCGGCGGCTCATCCGGCCGTGG 0: 1
1: 0
2: 0
3: 4
4: 77
Right 1160683284 19:422331-422353 CCGTGGGGGCCACAGGGGCCCGG 0: 1
1: 0
2: 5
3: 40
4: 427
1160683266_1160683279 21 Left 1160683266 19:422280-422302 CCCGGCGGCTCATCCGGCCGTGG 0: 1
1: 0
2: 0
3: 4
4: 77
Right 1160683279 19:422324-422346 TGTTCCTCCGTGGGGGCCACAGG 0: 1
1: 0
2: 0
3: 46
4: 162
1160683266_1160683276 12 Left 1160683266 19:422280-422302 CCCGGCGGCTCATCCGGCCGTGG 0: 1
1: 0
2: 0
3: 4
4: 77
Right 1160683276 19:422315-422337 TGACGCAGCTGTTCCTCCGTGGG 0: 1
1: 0
2: 0
3: 3
4: 64
1160683266_1160683277 13 Left 1160683266 19:422280-422302 CCCGGCGGCTCATCCGGCCGTGG 0: 1
1: 0
2: 0
3: 4
4: 77
Right 1160683277 19:422316-422338 GACGCAGCTGTTCCTCCGTGGGG 0: 1
1: 0
2: 0
3: 3
4: 97
1160683266_1160683281 23 Left 1160683266 19:422280-422302 CCCGGCGGCTCATCCGGCCGTGG 0: 1
1: 0
2: 0
3: 4
4: 77
Right 1160683281 19:422326-422348 TTCCTCCGTGGGGGCCACAGGGG 0: 1
1: 0
2: 0
3: 16
4: 171
1160683266_1160683275 11 Left 1160683266 19:422280-422302 CCCGGCGGCTCATCCGGCCGTGG 0: 1
1: 0
2: 0
3: 4
4: 77
Right 1160683275 19:422314-422336 CTGACGCAGCTGTTCCTCCGTGG 0: 1
1: 0
2: 0
3: 5
4: 109
1160683266_1160683278 14 Left 1160683266 19:422280-422302 CCCGGCGGCTCATCCGGCCGTGG 0: 1
1: 0
2: 0
3: 4
4: 77
Right 1160683278 19:422317-422339 ACGCAGCTGTTCCTCCGTGGGGG 0: 1
1: 0
2: 0
3: 6
4: 77
1160683266_1160683280 22 Left 1160683266 19:422280-422302 CCCGGCGGCTCATCCGGCCGTGG 0: 1
1: 0
2: 0
3: 4
4: 77
Right 1160683280 19:422325-422347 GTTCCTCCGTGGGGGCCACAGGG 0: 1
1: 0
2: 12
3: 22
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160683266 Original CRISPR CCACGGCCGGATGAGCCGCC GGG (reversed) Exonic
901109579 1:6784756-6784778 CCACGGCCGGCAGCGACGCCCGG + Intergenic
901476473 1:9493505-9493527 CCACAGCAGGAAGAGCAGCCTGG - Intergenic
902431495 1:16367122-16367144 CCAAGCCCGGAAGAGGCGCCAGG - Exonic
902870757 1:19312337-19312359 CCACGTCCAGATCCGCCGCCAGG - Exonic
1074503096 10:114043882-114043904 CCGCTGCTGGAAGAGCCGCCGGG - Intergenic
1076916676 10:133425884-133425906 CCGCAGCCGGAGGAGCCGCATGG - Intergenic
1076936780 10:133570679-133570701 CCGCAGCCGGAGGAGCCGCATGG - Intergenic
1080458496 11:32435165-32435187 CCAGGGCCGGAGGAGCCGCGGGG - Exonic
1085444201 11:76589774-76589796 CCACAGCAGGCTGAGCCGCAGGG + Intergenic
1096178342 12:49537907-49537929 CCGCGCCCAGAGGAGCCGCCGGG - Intergenic
1104366930 12:128186532-128186554 CCTAGACCGGATGAGCCTCCTGG + Intergenic
1107412651 13:40172278-40172300 CCGCGGCAGGAAGAGCCGCGGGG - Intergenic
1113459660 13:110473006-110473028 CCAGGGCCAGATGGGCCCCCTGG + Exonic
1113659777 13:112097992-112098014 CCACGGCTTGAGGAGCCGACAGG - Intergenic
1123035587 14:105470623-105470645 CCGCGGCCGGCCGAGCTGCCTGG + Exonic
1125404825 15:39341423-39341445 CCATGCCGGGATGAGCAGCCAGG - Intergenic
1125541172 15:40470986-40471008 CCCGGGCCGGATGTCCCGCCCGG - Exonic
1126905675 15:53362296-53362318 CCAAGGCCAGCTGAACCGCCTGG - Intergenic
1129850013 15:78788394-78788416 CCAGGGGCGGGTGAGCCGGCGGG + Intronic
1132268699 15:100503709-100503731 CCACTGCCAGAAGAGCTGCCAGG - Intronic
1134861088 16:17561258-17561280 CCCCGACCGGATGAACCGGCTGG - Intergenic
1135429829 16:22374084-22374106 GCACGGCCGGCCCAGCCGCCAGG + Intronic
1139489518 16:67279071-67279093 CCGCGGCTGAATGAGCCGACGGG - Exonic
1141184770 16:81779415-81779437 GCACGGCCAGGTGAGCTGCCCGG + Exonic
1141895685 16:86957421-86957443 CCACGGCAGGATGGGAAGCCAGG + Intergenic
1142051993 16:87965049-87965071 CCACAGACTGATGAGCCGCTGGG + Intronic
1142109151 16:88322114-88322136 CCACGGCAGGAGGTGCCGCCTGG + Intergenic
1142151935 16:88516433-88516455 CCAAGGCCAGAGGAGCCGCTGGG + Intronic
1142350386 16:89576780-89576802 CCACCGCCCGAGCAGCCGCCCGG - Intronic
1142434409 16:90047585-90047607 GCAGGGCAGGATGAGCCCCCGGG - Intergenic
1147382264 17:40062909-40062931 CCTCTGCCGGAGGAGCCGCGGGG + Exonic
1148334467 17:46832281-46832303 CCCGGGCCGGCTGAGCTGCCCGG + Intronic
1150278955 17:63917880-63917902 CCACGACTGGATGAGCAGCAGGG + Exonic
1152123225 17:78431595-78431617 CCACGGCCTGTTTAGCCGTCTGG - Intronic
1153414870 18:4835714-4835736 CCAGGGCAGGAAGAGCCGTCTGG - Intergenic
1156621583 18:38857798-38857820 CAACGGCTGGATGAGGAGCCTGG + Intergenic
1160683266 19:422280-422302 CCACGGCCGGATGAGCCGCCGGG - Exonic
1160710477 19:548941-548963 CAACGGCCGGATGGTCCGGCTGG - Exonic
1160766108 19:808775-808797 CCCCGGCCCCATGAGCCCCCCGG - Intronic
945067006 2:205956052-205956074 CCAGGGCTGGATGAGCTGCTAGG - Intergenic
1168975339 20:1961630-1961652 CCATGGCAGGATAAGCGGCCAGG + Intergenic
1170804652 20:19618961-19618983 CCACGGCAGGGTGAACCACCAGG + Intronic
1171120932 20:22568429-22568451 CCCCGTCCGGATGAGCCCGCTGG - Intergenic
1174509781 20:51042350-51042372 CCACGGCAGGATGAGTAGCTGGG - Intergenic
1175699389 20:61125974-61125996 CCACGGCAGGAGGGGCGGCCTGG + Intergenic
1176088488 20:63308714-63308736 CCAGGGCCGGGGGAGCCGCATGG - Intronic
1176549233 21:8214359-8214381 ACACGGCCGGACCCGCCGCCGGG - Intergenic
1176557126 21:8258582-8258604 ACACGGCCGGACCCGCCGCCGGG - Intergenic
1176568165 21:8397397-8397419 ACACGGCCGGACCCGCCGCCGGG - Intergenic
1176576068 21:8441617-8441639 ACACGGCCGGACCCGCCGCCGGG - Intergenic
1183095801 22:35551660-35551682 CCACGGCGAGCTGTGCCGCCAGG + Exonic
1203254118 22_KI270733v1_random:130675-130697 ACACGGCCGGACCCGCCGCCGGG - Intergenic
1203262174 22_KI270733v1_random:175754-175776 ACACGGCCGGACCCGCCGCCGGG - Intergenic
961461353 3:127052304-127052326 CCTCGGCAGGCAGAGCCGCCCGG - Intergenic
962816580 3:139006106-139006128 CCACGGCCGGGGTACCCGCCGGG + Exonic
962818077 3:139020499-139020521 CCACGGCCGGGTCCCCCGCCGGG + Exonic
985512148 5:318929-318951 CCACGGCCGGCTGCAGCGCCAGG - Intronic
990509985 5:56481174-56481196 CCCCGGCCGGAAGAGCCAGCTGG - Intronic
995787209 5:115842317-115842339 CGACGGGCGGAGGAACCGCCCGG - Intronic
997302174 5:132813997-132814019 CCGCGGCCAGTGGAGCCGCCAGG + Exonic
1002931222 6:1636626-1636648 CCATGGAGGGATGAGCCCCCAGG + Intronic
1004398432 6:15266900-15266922 CCACGGCCTGGTGATCCTCCTGG - Intronic
1008092735 6:47309329-47309351 CCCCGGCCCGGTGACCCGCCCGG + Intronic
1015717946 6:136211327-136211349 CCGGGGCAGGATGAGCTGCCAGG + Intergenic
1016447774 6:144150566-144150588 CCTCGGCCGCAGGAGGCGCCGGG + Exonic
1018668927 6:166163816-166163838 CCAGGGCCGGCTGGGCAGCCAGG - Intronic
1019350973 7:553832-553854 CCACGGCCGGATCAGGGGCCAGG - Intronic
1019612621 7:1944673-1944695 CCACAGCCGGAAGAGCCTCTAGG + Intronic
1022653637 7:32298793-32298815 CCACGGCGGAGTGAGCAGCCCGG + Exonic
1027674457 7:81141837-81141859 CCAGGGCCGGCAGAGCCGGCCGG - Intergenic
1033630486 7:143152887-143152909 CCAAGGCAGGAGGACCCGCCTGG + Intergenic
1037841081 8:22245517-22245539 CCGCCGCCCGATGAGCCCCCGGG - Exonic
1044821815 8:96160433-96160455 CCCCGGGCGCAGGAGCCGCCAGG - Exonic
1049584616 8:143427123-143427145 CCACGGGTGGCTCAGCCGCCCGG - Intronic
1056753210 9:89366445-89366467 CCAGGGCCAGATGGGCCGCCAGG - Intronic
1061726162 9:132582993-132583015 CCTGGGCCGGATGCCCCGCCAGG - Exonic
1062044090 9:134417252-134417274 CCACGGCCAGCTCAGCCTCCAGG - Exonic
1062272112 9:135714409-135714431 CCCCGCCCGCATGTGCCGCCAGG + Intronic
1062442581 9:136577586-136577608 CCAGGGCCGGAGGAGCTGCGGGG + Intergenic
1062460651 9:136661320-136661342 CCAGGGCAGGATGAGCCCCTGGG + Intronic
1203470519 Un_GL000220v1:113819-113841 ACACGGCCGGACCCGCCGCCGGG - Intergenic
1203478340 Un_GL000220v1:157791-157813 ACACGGCCGGACCCGCCGCCGGG - Intergenic