ID: 1160683268

View in Genome Browser
Species Human (GRCh38)
Location 19:422281-422303
Sequence ACCACGGCCGGATGAGCCGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 48
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 44}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160683268_1160683285 30 Left 1160683268 19:422281-422303 CCGGCGGCTCATCCGGCCGTGGT 0: 1
1: 0
2: 0
3: 3
4: 44
Right 1160683285 19:422334-422356 TGGGGGCCACAGGGGCCCGGCGG 0: 1
1: 1
2: 4
3: 38
4: 474
1160683268_1160683284 27 Left 1160683268 19:422281-422303 CCGGCGGCTCATCCGGCCGTGGT 0: 1
1: 0
2: 0
3: 3
4: 44
Right 1160683284 19:422331-422353 CCGTGGGGGCCACAGGGGCCCGG 0: 1
1: 0
2: 5
3: 40
4: 427
1160683268_1160683276 11 Left 1160683268 19:422281-422303 CCGGCGGCTCATCCGGCCGTGGT 0: 1
1: 0
2: 0
3: 3
4: 44
Right 1160683276 19:422315-422337 TGACGCAGCTGTTCCTCCGTGGG 0: 1
1: 0
2: 0
3: 3
4: 64
1160683268_1160683280 21 Left 1160683268 19:422281-422303 CCGGCGGCTCATCCGGCCGTGGT 0: 1
1: 0
2: 0
3: 3
4: 44
Right 1160683280 19:422325-422347 GTTCCTCCGTGGGGGCCACAGGG 0: 1
1: 0
2: 12
3: 22
4: 111
1160683268_1160683275 10 Left 1160683268 19:422281-422303 CCGGCGGCTCATCCGGCCGTGGT 0: 1
1: 0
2: 0
3: 3
4: 44
Right 1160683275 19:422314-422336 CTGACGCAGCTGTTCCTCCGTGG 0: 1
1: 0
2: 0
3: 5
4: 109
1160683268_1160683279 20 Left 1160683268 19:422281-422303 CCGGCGGCTCATCCGGCCGTGGT 0: 1
1: 0
2: 0
3: 3
4: 44
Right 1160683279 19:422324-422346 TGTTCCTCCGTGGGGGCCACAGG 0: 1
1: 0
2: 0
3: 46
4: 162
1160683268_1160683277 12 Left 1160683268 19:422281-422303 CCGGCGGCTCATCCGGCCGTGGT 0: 1
1: 0
2: 0
3: 3
4: 44
Right 1160683277 19:422316-422338 GACGCAGCTGTTCCTCCGTGGGG 0: 1
1: 0
2: 0
3: 3
4: 97
1160683268_1160683281 22 Left 1160683268 19:422281-422303 CCGGCGGCTCATCCGGCCGTGGT 0: 1
1: 0
2: 0
3: 3
4: 44
Right 1160683281 19:422326-422348 TTCCTCCGTGGGGGCCACAGGGG 0: 1
1: 0
2: 0
3: 16
4: 171
1160683268_1160683278 13 Left 1160683268 19:422281-422303 CCGGCGGCTCATCCGGCCGTGGT 0: 1
1: 0
2: 0
3: 3
4: 44
Right 1160683278 19:422317-422339 ACGCAGCTGTTCCTCCGTGGGGG 0: 1
1: 0
2: 0
3: 6
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160683268 Original CRISPR ACCACGGCCGGATGAGCCGC CGG (reversed) Exonic
900124760 1:1064475-1064497 CCCACGGCCGGATGAGAAGTGGG + Intergenic
900862677 1:5244443-5244465 ACCACGGTGGGAAGAGGCGCAGG - Intergenic
905028966 1:34868839-34868861 CCCACTGCCGTACGAGCCGCCGG - Exonic
1080458498 11:32435166-32435188 TCCAGGGCCGGAGGAGCCGCGGG - Exonic
1083309549 11:61777365-61777387 AGACCGGCCGGATGAGGCGCTGG + Exonic
1085325163 11:75601067-75601089 ACCACAGGCGGAAGAGCCCCTGG + Intronic
1085444199 11:76589773-76589795 CCCACAGCAGGCTGAGCCGCAGG + Intergenic
1094202792 12:27810409-27810431 ACCACGTCCGGCTGAGTTGCTGG - Intergenic
1103273876 12:119695679-119695701 ACCTCAGCCTGATGAGCAGCTGG - Intronic
1105004210 12:132710990-132711012 GCCACGCCCGGCTGAGCCGCCGG + Exonic
1107412653 13:40172279-40172301 GCCGCGGCAGGAAGAGCCGCGGG - Intergenic
1114704946 14:24715279-24715301 CCCTCTGCCGGATGAGCCACAGG - Intergenic
1122979757 14:105186160-105186182 ACCACACCCGGAGGAGCAGCAGG + Intergenic
1125201810 15:37106913-37106935 ACCACCGCCAGCTGAGACGCTGG - Intergenic
1133079163 16:3305146-3305168 AGCACGGCCGGCCGGGCCGCGGG + Intronic
1142051991 16:87965048-87965070 GCCACAGACTGATGAGCCGCTGG + Intronic
1142151933 16:88516432-88516454 GCCAAGGCCAGAGGAGCCGCTGG + Intronic
1142329579 16:89442808-89442830 ATCACGGCCTGGTGAGCCTCCGG + Intronic
1144781340 17:17809991-17810013 CCAACGGCCGGAGGAGCCGCCGG + Exonic
1147382262 17:40062908-40062930 GCCTCTGCCGGAGGAGCCGCGGG + Exonic
1150278953 17:63917879-63917901 GCCACGACTGGATGAGCAGCAGG + Exonic
1151378738 17:73710263-73710285 AGCACGGCCGGCTGCACCGCTGG + Intergenic
1152519041 17:80844829-80844851 ACCCCGGCCAGATGAGCGGAGGG + Intronic
1160683268 19:422281-422303 ACCACGGCCGGATGAGCCGCCGG - Exonic
1166954172 19:46451548-46451570 ACCATGGCCGGATGAACCCTTGG - Intergenic
926672980 2:15592326-15592348 GCCAAGCCCAGATGAGCCGCGGG - Intronic
929138711 2:38648747-38648769 ACCACAGCAGGAAGAGCCACGGG - Intergenic
940126440 2:150330996-150331018 ACCATGGCCTGATGTGGCGCTGG + Intergenic
948513558 2:238488801-238488823 CCCATGGCTGGATCAGCCGCTGG - Intergenic
1170889685 20:20367439-20367461 ACCTTGGACGGATGGGCCGCTGG - Intergenic
1174509783 20:51042351-51042373 TCCACGGCAGGATGAGTAGCTGG - Intergenic
1182218826 22:28742069-28742091 ACCACGGCTAGATAGGCCGCCGG + Exonic
950767505 3:15284126-15284148 AGCACGGCCAGAGGAGCAGCTGG - Intronic
968726045 4:2248268-2248290 ACCACGGCCTCAAGAGCCACAGG + Exonic
969184650 4:5466176-5466198 ACCACAGCGGGAGGAGCCCCTGG + Intronic
979754440 4:124323911-124323933 ACCTCTGCCAGTTGAGCCGCTGG + Intergenic
985630205 5:1009919-1009941 ACCCCGGCTGGATGAGCTGGAGG + Intronic
997232921 5:132257249-132257271 CACACGGCAGGATGGGCCGCAGG + Intronic
999622277 5:153485555-153485577 ACTAGGGCCAGATGAGCTGCAGG + Intergenic
1001556753 5:172641906-172641928 AGCACGGCAGCATGTGCCGCGGG - Intronic
1027250180 7:76393838-76393860 ACCACCGCCGCCTGGGCCGCGGG - Exonic
1032055015 7:128677216-128677238 ACCACGCCCGGCTGAGCCCGTGG - Intronic
1034676624 7:152896814-152896836 ACCACGCCAGGATTAGCCCCAGG - Intergenic
1038779109 8:30555953-30555975 ACCACAGCCGGCAGAGCGGCAGG - Intronic
1057869519 9:98707981-98708003 CCCAGGGCCGGAGGGGCCGCGGG - Intronic
1062442579 9:136577585-136577607 TCCAGGGCCGGAGGAGCTGCGGG + Intergenic
1062460649 9:136661319-136661341 GCCAGGGCAGGATGAGCCCCTGG + Intronic
1198742093 X:139852543-139852565 ACCAAGGAAGGATAAGCCGCGGG + Intronic