ID: 1160683272

View in Genome Browser
Species Human (GRCh38)
Location 19:422297-422319
Sequence CGTCAGGAGCCCTGGTACCA CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 92}

Found 17 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160683272_1160683277 -4 Left 1160683272 19:422297-422319 CCGTGGTACCAGGGCTCCTGACG 0: 1
1: 0
2: 0
3: 13
4: 92
Right 1160683277 19:422316-422338 GACGCAGCTGTTCCTCCGTGGGG 0: 1
1: 0
2: 0
3: 3
4: 97
1160683272_1160683279 4 Left 1160683272 19:422297-422319 CCGTGGTACCAGGGCTCCTGACG 0: 1
1: 0
2: 0
3: 13
4: 92
Right 1160683279 19:422324-422346 TGTTCCTCCGTGGGGGCCACAGG 0: 1
1: 0
2: 0
3: 46
4: 162
1160683272_1160683294 28 Left 1160683272 19:422297-422319 CCGTGGTACCAGGGCTCCTGACG 0: 1
1: 0
2: 0
3: 13
4: 92
Right 1160683294 19:422348-422370 GCCCGGCGGGTAGGGGGGCTGGG 0: 1
1: 0
2: 0
3: 31
4: 281
1160683272_1160683293 27 Left 1160683272 19:422297-422319 CCGTGGTACCAGGGCTCCTGACG 0: 1
1: 0
2: 0
3: 13
4: 92
Right 1160683293 19:422347-422369 GGCCCGGCGGGTAGGGGGGCTGG 0: 1
1: 0
2: 4
3: 64
4: 598
1160683272_1160683280 5 Left 1160683272 19:422297-422319 CCGTGGTACCAGGGCTCCTGACG 0: 1
1: 0
2: 0
3: 13
4: 92
Right 1160683280 19:422325-422347 GTTCCTCCGTGGGGGCCACAGGG 0: 1
1: 0
2: 12
3: 22
4: 111
1160683272_1160683289 20 Left 1160683272 19:422297-422319 CCGTGGTACCAGGGCTCCTGACG 0: 1
1: 0
2: 0
3: 13
4: 92
Right 1160683289 19:422340-422362 CCACAGGGGCCCGGCGGGTAGGG 0: 1
1: 0
2: 0
3: 7
4: 125
1160683272_1160683285 14 Left 1160683272 19:422297-422319 CCGTGGTACCAGGGCTCCTGACG 0: 1
1: 0
2: 0
3: 13
4: 92
Right 1160683285 19:422334-422356 TGGGGGCCACAGGGGCCCGGCGG 0: 1
1: 1
2: 4
3: 38
4: 474
1160683272_1160683276 -5 Left 1160683272 19:422297-422319 CCGTGGTACCAGGGCTCCTGACG 0: 1
1: 0
2: 0
3: 13
4: 92
Right 1160683276 19:422315-422337 TGACGCAGCTGTTCCTCCGTGGG 0: 1
1: 0
2: 0
3: 3
4: 64
1160683272_1160683278 -3 Left 1160683272 19:422297-422319 CCGTGGTACCAGGGCTCCTGACG 0: 1
1: 0
2: 0
3: 13
4: 92
Right 1160683278 19:422317-422339 ACGCAGCTGTTCCTCCGTGGGGG 0: 1
1: 0
2: 0
3: 6
4: 77
1160683272_1160683290 21 Left 1160683272 19:422297-422319 CCGTGGTACCAGGGCTCCTGACG 0: 1
1: 0
2: 0
3: 13
4: 92
Right 1160683290 19:422341-422363 CACAGGGGCCCGGCGGGTAGGGG 0: 1
1: 0
2: 2
3: 15
4: 265
1160683272_1160683275 -6 Left 1160683272 19:422297-422319 CCGTGGTACCAGGGCTCCTGACG 0: 1
1: 0
2: 0
3: 13
4: 92
Right 1160683275 19:422314-422336 CTGACGCAGCTGTTCCTCCGTGG 0: 1
1: 0
2: 0
3: 5
4: 109
1160683272_1160683284 11 Left 1160683272 19:422297-422319 CCGTGGTACCAGGGCTCCTGACG 0: 1
1: 0
2: 0
3: 13
4: 92
Right 1160683284 19:422331-422353 CCGTGGGGGCCACAGGGGCCCGG 0: 1
1: 0
2: 5
3: 40
4: 427
1160683272_1160683287 19 Left 1160683272 19:422297-422319 CCGTGGTACCAGGGCTCCTGACG 0: 1
1: 0
2: 0
3: 13
4: 92
Right 1160683287 19:422339-422361 GCCACAGGGGCCCGGCGGGTAGG 0: 1
1: 0
2: 0
3: 12
4: 204
1160683272_1160683281 6 Left 1160683272 19:422297-422319 CCGTGGTACCAGGGCTCCTGACG 0: 1
1: 0
2: 0
3: 13
4: 92
Right 1160683281 19:422326-422348 TTCCTCCGTGGGGGCCACAGGGG 0: 1
1: 0
2: 0
3: 16
4: 171
1160683272_1160683292 23 Left 1160683272 19:422297-422319 CCGTGGTACCAGGGCTCCTGACG 0: 1
1: 0
2: 0
3: 13
4: 92
Right 1160683292 19:422343-422365 CAGGGGCCCGGCGGGTAGGGGGG 0: 1
1: 0
2: 1
3: 32
4: 363
1160683272_1160683291 22 Left 1160683272 19:422297-422319 CCGTGGTACCAGGGCTCCTGACG 0: 1
1: 0
2: 0
3: 13
4: 92
Right 1160683291 19:422342-422364 ACAGGGGCCCGGCGGGTAGGGGG 0: 1
1: 0
2: 0
3: 16
4: 215
1160683272_1160683286 15 Left 1160683272 19:422297-422319 CCGTGGTACCAGGGCTCCTGACG 0: 1
1: 0
2: 0
3: 13
4: 92
Right 1160683286 19:422335-422357 GGGGGCCACAGGGGCCCGGCGGG 0: 1
1: 0
2: 5
3: 46
4: 535

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160683272 Original CRISPR CGTCAGGAGCCCTGGTACCA CGG (reversed) Exonic
900335317 1:2160362-2160384 CGTCAGGAGGCGTGGCACCCGGG + Intronic
900862049 1:5240838-5240860 GGTCAGGAGACCTGGTGGCAGGG + Intergenic
900950561 1:5856118-5856140 CATGTGGGGCCCTGGTACCAGGG - Intergenic
901017124 1:6238225-6238247 TGGCAGGAGCTCTGGTACCTGGG + Intergenic
901893045 1:12284601-12284623 CGTCCAGAGCCCTGGAACCCCGG + Intronic
903293571 1:22329747-22329769 CGTCAGAAGACCTGATACCTGGG - Intergenic
903311559 1:22461967-22461989 CTTCAGCTGCCCTGTTACCAAGG + Intronic
905447169 1:38034899-38034921 CGTCAGGCGCTCGTGTACCAGGG - Intergenic
912305339 1:108560733-108560755 AGTCAGGAGCGCAGGAACCAAGG - Intronic
915303628 1:154965694-154965716 CGAGGGGAGCCCTGGTTCCATGG - Exonic
916271076 1:162942302-162942324 CATCAGGAGCATTAGTACCAGGG + Intergenic
922542068 1:226427219-226427241 AGTCAGGAGCCAGGGTGCCAAGG - Intergenic
922562922 1:226582098-226582120 GGTCAGGCTCCCTGGGACCAGGG - Intronic
1062813442 10:482210-482232 CATCGGGAGCCCTGGTAGCAGGG + Intronic
1067767144 10:49095420-49095442 CGGCAGGGTCCTTGGTACCAAGG + Intronic
1067877946 10:50020835-50020857 CCTCAGGAACCCTGGAACCCTGG + Intergenic
1069742647 10:70695400-70695422 CTGCAGGAGCCATGGTTCCAGGG + Intronic
1069937825 10:71930716-71930738 AGACGGGAGCCCTGGCACCAGGG + Intergenic
1071905998 10:90174096-90174118 CTTCTGGAGCCCTGGTACCTGGG - Intergenic
1072230418 10:93409671-93409693 AGTCAGGGGCCCTGGGCCCAAGG - Exonic
1072682235 10:97515959-97515981 GATCAGGAGCTCTGGTCCCAGGG + Intronic
1074755471 10:116621211-116621233 GGTCAGGAGCCCGGGTCACAAGG - Intronic
1075709329 10:124522287-124522309 CGCCAGGAGTCCTGGGAACAGGG - Intronic
1079285028 11:19121197-19121219 CATCAGGAGCCCTGACACCTGGG - Intronic
1079799639 11:24853240-24853262 CTTCAGGAGCTCTTGTAACATGG + Intronic
1081527599 11:43937142-43937164 TGTCAGGAGCCGTGGAAGCAGGG + Intronic
1083860401 11:65417309-65417331 CCGCAGAAGCCCTGGCACCATGG + Intergenic
1084360200 11:68664295-68664317 CCTCAGGAGCCCTGGAACCCGGG + Intergenic
1085038192 11:73311919-73311941 GGTCAGGTGCCCAGGTGCCAAGG + Intronic
1098932059 12:76430003-76430025 AGTCAGCAGGCCTGTTACCAGGG - Intronic
1101345143 12:103879518-103879540 AGGCAGGAGCCCAAGTACCAAGG - Intergenic
1104805520 12:131586947-131586969 CGTGAGCAGCCTGGGTACCATGG + Intergenic
1121884959 14:97534588-97534610 CCTCAGGAGCCCTGAAACCTTGG + Intergenic
1124363723 15:29056749-29056771 AGTCAGGGCCCCTGGCACCAGGG - Intronic
1124854194 15:33371343-33371365 CTGCAGGAGCCTTGATACCATGG - Intronic
1126661668 15:51038915-51038937 TGTCAGCAGCCCTGCTACTAGGG + Intergenic
1128543418 15:68552153-68552175 GATCAGGAGACCTGGTTCCAGGG - Intergenic
1128735602 15:70052246-70052268 GGTCAGGAGGCCTGGTTCCAGGG + Intronic
1129193951 15:73953321-73953343 CCTCAGGGTCCCTGGTAGCAAGG + Intergenic
1129989862 15:79952377-79952399 CCTCAGGAGCCATGTTACCAAGG + Intergenic
1135101166 16:19607257-19607279 AGTGAGGATCCTTGGTACCAGGG - Intronic
1136065354 16:27754723-27754745 AGTCAGAAGACCTGGTACCCTGG - Intronic
1137668839 16:50267481-50267503 CGACAGGGGCCCTGGGTCCAAGG + Intronic
1140022431 16:71251267-71251289 CGTGAGGACCCCTGCTACCAGGG + Intergenic
1141625768 16:85260189-85260211 TGTCAGGTGTCCAGGTACCATGG - Intergenic
1142236707 16:88925823-88925845 CATAGGGAGCCCCGGTACCAAGG + Intronic
1143171479 17:4933065-4933087 CGTCAGGAGCCCTGGGGGCAGGG - Exonic
1143560272 17:7689578-7689600 CGTCAGGAGCCCTAGAAACAGGG - Exonic
1145741418 17:27277963-27277985 CATGAGAATCCCTGGTACCAGGG + Intergenic
1147026630 17:37590802-37590824 CCTCAGCATCCCTAGTACCAGGG - Intronic
1151139324 17:71976407-71976429 CCCCATGAGCCCTGGTAGCAAGG + Intergenic
1151420040 17:73991115-73991137 CAGCAGGGGCCCTGGGACCAGGG + Intergenic
1153814188 18:8778953-8778975 TGTCAGAAACCCTGGTACCTGGG + Intronic
1155361542 18:25007960-25007982 CAACAGCAGCCATGGTACCAAGG - Intergenic
1160683272 19:422297-422319 CGTCAGGAGCCCTGGTACCACGG - Exonic
1161298503 19:3531816-3531838 GGTGAGGAGCCCGGGTCCCATGG + Exonic
1164566308 19:29328464-29328486 GGTCACAAGCCCTGGTCCCAAGG + Intergenic
1167114943 19:47483719-47483741 GGTCAGGATCCCTAGTACCCAGG - Intronic
1167661084 19:50796514-50796536 CGTAGGGAGCCCTGGTACAGTGG + Intergenic
1168689321 19:58367315-58367337 CTTCAGGAGCCTTGGGACCGCGG - Intergenic
933726376 2:85429861-85429883 TGACAGGTACCCTGGTACCAGGG - Intronic
935404830 2:102698148-102698170 TGTCAGGAGTCCTGGTCCAATGG + Intronic
940367764 2:152867668-152867690 CCTTATGAGCTCTGGTACCATGG + Intergenic
941033020 2:160534680-160534702 AGACATGAGCCCTGGTCCCAAGG + Intergenic
948632707 2:239312285-239312307 TGCTAGGAGCCCTGGCACCAAGG - Intronic
1171317910 20:24211634-24211656 CGTCCTGAGCCCTGGGGCCAGGG + Intergenic
1176107107 20:63394637-63394659 CATCAGCAGCCCTGGTCTCAAGG - Intergenic
1179818658 21:43923761-43923783 GGACAGAAGCCCTGGTACCCAGG - Intronic
1184854027 22:47136721-47136743 CCTCAGCAGTCCTGGTCCCACGG - Intronic
949140597 3:628235-628257 GGGCAGGAGCTCTGGGACCATGG - Intergenic
953018741 3:39100625-39100647 CCTCAGGATCCCTGGGCCCAGGG + Intronic
953930589 3:47003893-47003915 CTCCAGCAGCCCTGGGACCACGG - Exonic
955203930 3:56878154-56878176 CAGCAGGAGCTCTGGCACCAAGG + Intronic
955474304 3:59320087-59320109 CGTCAGGACCCCTGAAAACATGG + Intergenic
960619058 3:119621785-119621807 GGTCAGGAGGCCTGGATCCAAGG - Intronic
963535660 3:146525019-146525041 CCTAAGGAGCCCTGGACCCAAGG + Intronic
975232964 4:71956381-71956403 CTTCAGCAGCCCTGGTAGTAGGG - Intergenic
977179590 4:93857428-93857450 CGTCATGAGCACTCGTCCCATGG + Intergenic
985590743 5:763641-763663 CATCAGGAGCCCACGTGCCATGG - Intronic
998233006 5:140373471-140373493 GGTCAGAAGCCCTGCTCCCATGG - Intronic
998394023 5:141806644-141806666 CCTGAGGAGCCCTGGCACCGAGG + Intergenic
999321640 5:150618824-150618846 GGTCAGGAGCCCTTGTACTAAGG - Intronic
999917060 5:156274128-156274150 CGTGAGGAGGTTTGGTACCAGGG + Intronic
1000917988 5:167105399-167105421 CCTCAGGAGCCTTGGGACAAAGG - Intergenic
1008591825 6:53001001-53001023 CGTGAGGATCCCTGGAACCTAGG - Intergenic
1012090605 6:94889597-94889619 AGGCATGAGCCATGGTACCATGG + Intergenic
1012315106 6:97775480-97775502 AGTCAGGAGGCATGGTATCAGGG - Intergenic
1013783739 6:113756448-113756470 CTTCTGGAGTCCTGGTCCCAGGG - Intergenic
1019720677 7:2568691-2568713 CGTCAGGAGCCCGGGCCCGATGG + Intronic
1020996976 7:15278031-15278053 AGTCATGAGCCCTGGGACCAGGG - Intronic
1021157671 7:17231717-17231739 GGCCAGGAGGCCTGCTACCAGGG + Intergenic
1026928627 7:74210558-74210580 CCTGAGCAGCCCTGGTCCCAGGG - Intronic
1029281702 7:99439475-99439497 AGTCAGGAGTCCTGAAACCAAGG - Intronic
1032496256 7:132365058-132365080 TCTCAGGAGCCCTGGTAGGAAGG - Intronic
1034622151 7:152464296-152464318 CGGCAGGAGCCGTGGTTCCGCGG + Intergenic
1040368755 8:46747200-46747222 CATCAGGAGGCCTAATACCAAGG - Intergenic
1040384509 8:46905144-46905166 AGGCAAGAGCCCTGGTAGCAGGG - Intergenic
1056281290 9:85043433-85043455 TGTCAGGAGCCCAGTTACCATGG + Intergenic
1056558135 9:87706745-87706767 GGTCAGGAGCCCTGGCAGCGTGG - Exonic
1059666346 9:116449838-116449860 CTTCAGCAGCCCTGGTACCTAGG + Intronic
1059666347 9:116449847-116449869 CATCTGGAGCCTAGGTACCAGGG - Intronic
1060599995 9:124870952-124870974 CGTCAGAAACCTTGTTACCATGG + Intronic
1061974487 9:134061482-134061504 AGACAGGAGCACTGGAACCAAGG + Intronic
1199501247 X:148508989-148509011 GGTCAGGAGCCCTTGTACCCTGG + Intronic
1199805552 X:151296605-151296627 TGGCAGGAGCACTGGTACCCAGG - Intergenic
1202042167 Y:20697146-20697168 AGTCAGGAGCCCTGGGACAGGGG - Intergenic