ID: 1160683277

View in Genome Browser
Species Human (GRCh38)
Location 19:422316-422338
Sequence GACGCAGCTGTTCCTCCGTG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 97}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160683272_1160683277 -4 Left 1160683272 19:422297-422319 CCGTGGTACCAGGGCTCCTGACG 0: 1
1: 0
2: 0
3: 13
4: 92
Right 1160683277 19:422316-422338 GACGCAGCTGTTCCTCCGTGGGG 0: 1
1: 0
2: 0
3: 3
4: 97
1160683271_1160683277 0 Left 1160683271 19:422293-422315 CCGGCCGTGGTACCAGGGCTCCT 0: 1
1: 0
2: 1
3: 10
4: 129
Right 1160683277 19:422316-422338 GACGCAGCTGTTCCTCCGTGGGG 0: 1
1: 0
2: 0
3: 3
4: 97
1160683266_1160683277 13 Left 1160683266 19:422280-422302 CCCGGCGGCTCATCCGGCCGTGG 0: 1
1: 0
2: 0
3: 4
4: 77
Right 1160683277 19:422316-422338 GACGCAGCTGTTCCTCCGTGGGG 0: 1
1: 0
2: 0
3: 3
4: 97
1160683263_1160683277 24 Left 1160683263 19:422269-422291 CCTCTCTGCCGCCCGGCGGCTCA 0: 1
1: 0
2: 1
3: 11
4: 167
Right 1160683277 19:422316-422338 GACGCAGCTGTTCCTCCGTGGGG 0: 1
1: 0
2: 0
3: 3
4: 97
1160683268_1160683277 12 Left 1160683268 19:422281-422303 CCGGCGGCTCATCCGGCCGTGGT 0: 1
1: 0
2: 0
3: 3
4: 44
Right 1160683277 19:422316-422338 GACGCAGCTGTTCCTCCGTGGGG 0: 1
1: 0
2: 0
3: 3
4: 97
1160683265_1160683277 16 Left 1160683265 19:422277-422299 CCGCCCGGCGGCTCATCCGGCCG 0: 1
1: 0
2: 0
3: 4
4: 57
Right 1160683277 19:422316-422338 GACGCAGCTGTTCCTCCGTGGGG 0: 1
1: 0
2: 0
3: 3
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160683277 Original CRISPR GACGCAGCTGTTCCTCCGTG GGG Exonic
901985743 1:13074028-13074050 GACCCAGCTGTTCCTTCGGTTGG - Intronic
901996066 1:13152739-13152761 GACCCAGCTGTTCCTTCGGTTGG + Intergenic
902167763 1:14586008-14586030 GACACAGCTGTTCCCTAGTGGGG + Intergenic
904344308 1:29857888-29857910 GAGGCAGCTGGTGCTCTGTGAGG + Intergenic
906315890 1:44786278-44786300 GAGGCTGCTGTTCCGCCGTCTGG + Intronic
907851361 1:58258179-58258201 GACACAGCTGCTCCTTCGCGGGG - Intronic
914950254 1:152107804-152107826 GGCGTAGCTGTTCCTCCTCGCGG + Exonic
914950264 1:152107876-152107898 GGCGGAGCTGTTCCTCCTCGCGG + Exonic
914950281 1:152108020-152108042 GGCGCAGCTGTTCCTCCTCACGG + Exonic
914950344 1:152108524-152108546 GGCGCAGCTGTTCCTCCTCGCGG + Exonic
914950430 1:152109181-152109203 GGAGCAGCTGTTCCTCCTCGCGG + Exonic
915405297 1:155655646-155655668 GACGAAGCTGTTGCTTGGTGTGG + Intergenic
916460105 1:165014967-165014989 GAGGCACCTGTTCCTCTGGGCGG - Intergenic
923031428 1:230252049-230252071 GGGGCATCTGTCCCTCCGTGAGG + Intronic
1067187847 10:44045169-44045191 GGCGGAGCTTTTCCTTCGTGGGG + Intergenic
1069753523 10:70760101-70760123 GACGCTGCTGCTGCTGCGTGTGG + Intronic
1070841444 10:79490656-79490678 CACGCAGCTGTTCCTGAGTTGGG - Intergenic
1076720265 10:132389361-132389383 CACTCACCAGTTCCTCCGTGGGG + Intergenic
1083885526 11:65571763-65571785 AAAACAGCTGTTCCTCTGTGTGG + Exonic
1088368450 11:109063274-109063296 GACTCAGCTGTTCCTCATTCAGG + Intergenic
1096614942 12:52826926-52826948 GGCCCAGCAGTGCCTCCGTGGGG - Intronic
1097582942 12:61480981-61481003 GACTCAGCTGTTCCAACCTGTGG + Intergenic
1103855340 12:123965026-123965048 GACCCAGCAGCTCATCCGTGGGG - Intronic
1105505910 13:21009695-21009717 GTAGCAGCTGTTCCTCCATCTGG - Intronic
1105699789 13:22927075-22927097 TCCGCAGCTCGTCCTCCGTGCGG - Intergenic
1118602212 14:67478737-67478759 GACCCAGCTCCTCCTCTGTGAGG + Intronic
1118693071 14:68359024-68359046 GTGGCAGCTGCTCCTCTGTGGGG - Intronic
1123021987 14:105403160-105403182 GACCAAGCTGTGCCTACGTGTGG + Intronic
1125004223 15:34799627-34799649 ATCTCAGCTGTTCCTCCGTTCGG + Intergenic
1127723037 15:61721465-61721487 GACGCAGCTGCTCCTCCAACAGG + Intergenic
1129266415 15:74395801-74395823 GACTCAGCTCTGCCTCTGTGAGG - Intergenic
1132601019 16:773009-773031 GCCGCAGCTGATCCTCCGGGAGG + Exonic
1133117097 16:3583510-3583532 GATCCACCTGTTCCTCCGTCAGG - Exonic
1138526341 16:57609738-57609760 GACGCAGTGGTGCCTCCCTGAGG - Intergenic
1141979583 16:87541607-87541629 GACGCAGCTGCTCTGCGGTGAGG - Intergenic
1142136682 16:88454745-88454767 GACGCAGGTCTTCCTCCCCGGGG + Intronic
1143636144 17:8164584-8164606 GACGCGGCTGCTCCTCTGAGGGG - Intergenic
1147121568 17:38338160-38338182 AAGGAAGCTGCTCCTCCGTGGGG - Intronic
1147528541 17:41251020-41251042 CACGCAGCTGTTTCTCACTGAGG - Intronic
1152930762 17:83108487-83108509 GACGAAGCTGTTGCTTCGGGAGG + Intergenic
1156913863 18:42442562-42442584 GAGGTAGCTGTTCCTCTGAGAGG + Intergenic
1160400835 18:78610368-78610390 CACCCAGCTGTGCTTCCGTGGGG - Intergenic
1160683277 19:422316-422338 GACGCAGCTGTTCCTCCGTGGGG + Exonic
1161042304 19:2116649-2116671 GACGCCGCTGCTCCTCCTCGTGG + Exonic
1164405490 19:27941780-27941802 AAAGCAGCTATTCCTCTGTGTGG - Intergenic
1164682945 19:30148009-30148031 GATGCAGCTGTCCCTGGGTGTGG + Intergenic
1164683565 19:30151920-30151942 GATGCAGCTGTCCCTGAGTGTGG + Intergenic
1168348913 19:55664648-55664670 GACACAGATGTGCCTCCGTCTGG - Intronic
925553270 2:5099353-5099375 AACCCAGCAGTTCCACCGTGAGG - Intergenic
926296627 2:11573647-11573669 GACCCAGCTGCTCTTCTGTGAGG - Intronic
927146743 2:20171142-20171164 GATGCACCTGTTCCTCCTTCGGG - Intergenic
931401812 2:61938238-61938260 CAGGAAGCTGCTCCTCCGTGGGG - Intronic
949070304 2:242020489-242020511 GATGTGGCTGTTCCTCTGTGAGG + Intergenic
1171411938 20:24953388-24953410 GATGATCCTGTTCCTCCGTGGGG + Intronic
1177249210 21:18570331-18570353 GCAGCAGCAGTTCCTCCCTGCGG - Intergenic
1179970562 21:44834945-44834967 GACCCAGCAGGTCCTCGGTGGGG + Intergenic
1180100246 21:45580578-45580600 GAGGCAGCTGTGTCTCCGTCAGG - Intergenic
1182623736 22:31631270-31631292 GAAGAAGCTGGTCCTCAGTGAGG - Intronic
1185066619 22:48635474-48635496 GCAGCAGCTCCTCCTCCGTGAGG + Intronic
952342565 3:32458152-32458174 TCCGCAGCTGCTCCTCCCTGGGG - Intronic
952673666 3:36000751-36000773 GACTCAGCTGTTCCAACCTGTGG - Intergenic
958942653 3:100332736-100332758 GACACAGCTGTTCCTCCACCAGG + Intergenic
962240201 3:133745818-133745840 GAGGGAGCAGCTCCTCCGTGGGG + Intergenic
968483862 4:849450-849472 GAATCAGCTGTTCCTTCGGGAGG + Exonic
969131618 4:4994769-4994791 GACTCAGCTTTTCCTCCAGGTGG + Intergenic
970501684 4:16683840-16683862 GACCCAGCTCTTCCTTCCTGTGG + Intronic
971826575 4:31631050-31631072 CACTCAGCTGTTACTCCATGTGG - Intergenic
982198527 4:152937766-152937788 GACGCAGCTGGGGCTCCGCGCGG + Intronic
985691507 5:1315222-1315244 GACACTGCAGTTCCACCGTGGGG + Intergenic
991610153 5:68441377-68441399 GAAGTGGCTGTTCCTCAGTGGGG + Intergenic
992069504 5:73136224-73136246 GATGCAGCTTTTCCTCCCTAAGG + Intergenic
996524497 5:124463675-124463697 GACACAGCAGCTCCTCAGTGAGG + Intergenic
1001692951 5:173646388-173646410 GACACAGCTGTTCCTCCACTGGG + Intergenic
1001843969 5:174904440-174904462 GACTCAGCTGTTCCAGCCTGTGG + Intergenic
1002293625 5:178215831-178215853 GAAGCAGCTTTTCCTGGGTGGGG - Intronic
1005903718 6:30242146-30242168 GACACGGCTGTTCCTCCTTTTGG - Intergenic
1006719920 6:36143356-36143378 TACGGAGCTGTTCCTCCATCAGG - Intronic
1006824799 6:36926887-36926909 GACTCAGATGTGCCTCCGTTGGG + Intronic
1017913406 6:158814244-158814266 ACCACAGCTGTTCCTCCCTGTGG + Intronic
1018709642 6:166488887-166488909 GATGCCGCAGTTCCTCAGTGGGG - Exonic
1019166289 6:170099727-170099749 GACGCAGCTTCCTCTCCGTGTGG - Intergenic
1019446868 7:1075935-1075957 GACTCTGCTGTTCCTACCTGAGG - Intronic
1024578714 7:50784582-50784604 GAAGCAGCTGTTCCTGGATGTGG + Intronic
1029106402 7:98179850-98179872 CACGCAGCTGGTCCTCAATGTGG - Intronic
1029996399 7:105012607-105012629 GCCGCAGCTGTTCTGCCGTATGG + Intergenic
1031051990 7:116953900-116953922 GGCGCAGCTCTTCCTCCGCGGGG - Exonic
1034536067 7:151726648-151726670 GATGCAGCCGTGCCTGCGTGCGG - Intronic
1040881798 8:52213418-52213440 GCCACAGCTTTTCCTCTGTGAGG + Intronic
1041623374 8:59999097-59999119 GACTCAGCTGTTCCAGCCTGTGG + Intergenic
1041890048 8:62858704-62858726 GACTCAGCTGTTCCAGCCTGTGG - Intronic
1041972627 8:63760928-63760950 GACTCAGCTGTTCCAGCCTGTGG - Intergenic
1044392138 8:91663612-91663634 ACAGCAGCTGTTCCTCCCTGTGG - Intergenic
1047552705 8:125893909-125893931 GAAGTAGCTGTTCATCCTTGGGG + Intergenic
1049393054 8:142381871-142381893 GCCGCAGCTCATCCTGCGTGTGG + Intronic
1049983367 9:925137-925159 TACGAAGCTGACCCTCCGTGTGG - Intronic
1058012999 9:99999020-99999042 GGCGCAGCTGCTCCTTGGTGAGG + Intronic
1061714187 9:132508724-132508746 GACGCAGCGGTCACTCAGTGGGG - Intronic
1190803569 X:53814159-53814181 GACTCAGCTGTTCCAGCCTGTGG - Intergenic
1191716955 X:64200316-64200338 GACCCAGCTGCTCCTCTGTAGGG - Intronic
1192343736 X:70284259-70284281 CACACAGCTGTTCCGGCGTGTGG + Exonic
1192351832 X:70362293-70362315 AACTCAGCTCTTTCTCCGTGGGG + Intronic