ID: 1160683387

View in Genome Browser
Species Human (GRCh38)
Location 19:422820-422842
Sequence AGGGCACATTGGAGGCCCCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 139}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160683387_1160683392 -1 Left 1160683387 19:422820-422842 CCGCGGGGCCTCCAATGTGCCCT 0: 1
1: 0
2: 1
3: 11
4: 139
Right 1160683392 19:422842-422864 TAAATACTCAAGACGACAGCCGG 0: 1
1: 0
2: 0
3: 2
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160683387 Original CRISPR AGGGCACATTGGAGGCCCCG CGG (reversed) Intronic
900334088 1:2152689-2152711 AAGGCAGATTGGAGGCCATGGGG - Intronic
901972345 1:12918053-12918075 GGGGCACCATGGAGGCCCAGAGG + Intronic
902012834 1:13283709-13283731 GGGGCACCATGGAGGCCCAGAGG - Intronic
905517421 1:38572108-38572130 AGGGCACACTGGGGGCCCTGGGG - Intergenic
907450521 1:54542892-54542914 AGGGCATATCTGAGGCCCCTAGG + Intronic
915117736 1:153611029-153611051 AGGGCCCATTGGAGGACACGTGG - Intronic
915349621 1:155216248-155216270 ATGGCACCCTGGAGGTCCCGGGG + Intergenic
916002849 1:160633368-160633390 GGGGCACACTGGAGGCCAGGTGG + Intronic
917028480 1:170665691-170665713 CGGGCACAGTGGTGGCCCCGCGG + Intronic
917229788 1:172823541-172823563 AGGACACAGTGGAGCCCCCAGGG - Intergenic
917523963 1:175770897-175770919 TGGCCACATTGGAGACCCAGGGG - Intergenic
1067314753 10:45151107-45151129 AGGGCACCATGGAGGCCATGGGG + Intergenic
1069820997 10:71228745-71228767 TGGGCACAGAGGAGGCCCCGTGG - Intronic
1075656017 10:124161848-124161870 AGGGCACACTGGGGACCCTGGGG - Intergenic
1075714558 10:124548540-124548562 GGTGCACAGTGGGGGCCCCGAGG - Intronic
1076571907 10:131438683-131438705 AGGACACTGTGGTGGCCCCGGGG - Intergenic
1076761654 10:132608830-132608852 AGGCCAGAGTGGAGGCCCAGGGG + Intronic
1076865556 10:133164698-133164720 AGGGGCCCTTGGAGACCCCGGGG - Intronic
1077579323 11:3406724-3406746 AGCACACACTGGAGGCCACGAGG + Intergenic
1078146671 11:8726392-8726414 AAGGCACATTGCAGGCACCCAGG - Intronic
1081850852 11:46274215-46274237 AGGGCACATTGGAAGATCCTTGG + Intergenic
1083271975 11:61577257-61577279 AGGACACAGTGGAGGACCTGAGG - Intronic
1084143520 11:67250460-67250482 TGGGCACAATGGATGTCCCGTGG - Exonic
1085295804 11:75431016-75431038 AGGGCGCCTTGGCCGCCCCGGGG + Intergenic
1085427064 11:76414037-76414059 AGGCTACATTGGAGGCCGCTGGG + Intronic
1086064718 11:82733102-82733124 AGGGGACGTGGCAGGCCCCGCGG - Exonic
1086988895 11:93281047-93281069 AGGGCACAGTGATGGCCCAGAGG - Intergenic
1089699826 11:120237897-120237919 AGGGCTTATTGGAGGCCCAAGGG - Intronic
1091461263 12:644973-644995 AGGCCAGACTGGAGGCCCAGTGG + Intronic
1092407258 12:8229674-8229696 AGCACACACTGGAGGCCACGAGG + Intergenic
1101739152 12:107486705-107486727 AGAGCCCCTTGGAGGTCCCGAGG - Intronic
1102015956 12:109648210-109648232 AGGGCATTTTGGTGGCCCCAAGG + Intergenic
1104715020 12:131010876-131010898 AGGGCACAGTCGCTGCCCCGGGG - Intronic
1104939317 12:132387459-132387481 AGGCCCCATTGCAGGCCCTGGGG - Intergenic
1105503189 13:20989527-20989549 AGGGCACATGGGAGGGCCAAGGG + Intronic
1110089256 13:71424636-71424658 CGGGCACATCTGAGGCCCCTGGG + Intergenic
1110366950 13:74697549-74697571 AAGGAAAATTGGAGGCCCCTGGG + Intergenic
1113441292 13:110330661-110330683 AGGGCACGATGGGGTCCCCGCGG + Intronic
1113457372 13:110458203-110458225 AGGGCACAGAGGATGCCCAGTGG - Intronic
1115654563 14:35431031-35431053 GGGGCACTTTGGAAGCCCCTTGG + Intergenic
1119426030 14:74535261-74535283 AGGGCACCTTGGAGGCCATCTGG + Intronic
1119810948 14:77518955-77518977 AAGCCAAATTGGAGGCCCTGTGG + Intronic
1121173069 14:91870487-91870509 ATGGCACAGTTGAGGCACCGAGG - Intronic
1122128433 14:99591579-99591601 AAGGCACATTGCAGGCCCTCAGG - Intronic
1122141215 14:99664149-99664171 AGGGCCCACTGGGGGCCCCTGGG - Intronic
1122738130 14:103855493-103855515 AGGGCAGAAGGGAGGCCCCGAGG - Intergenic
1122861957 14:104586737-104586759 AGAGGAGATTGGAGGCCCCCAGG + Intronic
1125359437 15:38850001-38850023 AGGGCAGGTTGGTGGCCCAGTGG - Intergenic
1129336321 15:74854229-74854251 AAGGCCCAGTGCAGGCCCCGAGG - Intronic
1132316210 15:100892225-100892247 AGGGCCCCTTGGAGGCCAGGCGG - Intronic
1133278053 16:4649848-4649870 AGGCCACCTTGGAAGGCCCGAGG + Intronic
1137753312 16:50882389-50882411 GGGGCACCCTGGAAGCCCCGGGG + Intergenic
1139823702 16:69740578-69740600 AGGGCACGTTGGAGTCACCCAGG + Intergenic
1140113566 16:72023210-72023232 AGGGCACCCTGGAGGCCCGCAGG - Exonic
1148809828 17:50283374-50283396 AAAGCACATTGGAGGAACCGAGG - Intergenic
1151625753 17:75274525-75274547 AGGGCACGTGGGAGGACCAGTGG - Intronic
1152278886 17:79373622-79373644 AGCCCACACTGGAGGCCCCTGGG + Intronic
1152387431 17:79983330-79983352 AGTGCACATTGCAGGGCCCAGGG + Intronic
1152903228 17:82957047-82957069 TGGGCTCCCTGGAGGCCCCGAGG + Intronic
1155785909 18:29899130-29899152 AGGCCACACTGGAGCCCACGGGG + Intergenic
1159925410 18:74264660-74264682 AGGACACAATGGAGGCACGGAGG + Intronic
1160683387 19:422820-422842 AGGGCACATTGGAGGCCCCGCGG - Intronic
1160704618 19:524216-524238 AGGGATCAGGGGAGGCCCCGGGG - Intergenic
1160779120 19:870061-870083 AGGTCACCTTGCAGGGCCCGGGG - Intronic
1162950679 19:14070595-14070617 TGGGGCCACTGGAGGCCCCGGGG - Intergenic
1163375236 19:16926262-16926284 AGGGGACATTGGGGGTCCCAGGG - Intronic
1165901975 19:39173392-39173414 AGGGGACAGTGGGGGCCCTGGGG - Intronic
1166353987 19:42216605-42216627 AGGGCACCAGGGAGGCCCAGCGG + Intronic
1167605884 19:50481090-50481112 AGGACACACAGGAGGCCCGGAGG - Intronic
1168134037 19:54338580-54338602 AGGGCACCCTGGAGGCCCAGGGG - Exonic
926410473 2:12597192-12597214 AGGGCACATTAAAGCCCCAGGGG + Intergenic
928385351 2:30862897-30862919 TGGGCACATTGAAGTCCCAGTGG + Intergenic
931428954 2:62195212-62195234 AGGGCGCATCGGTGGGCCCGGGG + Intergenic
935954941 2:108366519-108366541 AGGACACAGAGAAGGCCCCGTGG + Intergenic
937346890 2:121131761-121131783 AGGGAACATCCGTGGCCCCGTGG + Intergenic
938147370 2:128848051-128848073 ATGGCACATGTGAGGCCCCAGGG + Intergenic
938725448 2:134104758-134104780 AGGGAATATTGGAGGCCCACTGG - Intergenic
939685959 2:145200405-145200427 AGGGCACATTGGACAGCCCTGGG - Intergenic
946603344 2:221374910-221374932 TGCGCACATTGGAGGACCCTGGG + Intergenic
948454755 2:238099818-238099840 TGAGCCCATTGCAGGCCCCGTGG + Intergenic
1170338085 20:15293680-15293702 AGGACACCTTGTAGGCCCCAGGG + Intronic
1170890132 20:20369007-20369029 AGGGCCCGGTGGAGGCGCCGCGG + Exonic
1171908766 20:30922000-30922022 AAGGCACGAGGGAGGCCCCGAGG - Intergenic
1172106989 20:32522828-32522850 AGAGCTCAGTGGAGGGCCCGGGG + Intronic
1174382967 20:50169224-50169246 AGGGCACATGGGTGGCTCAGGGG - Intergenic
1176035086 20:63032234-63032256 AGGCCAGATCTGAGGCCCCGAGG - Intergenic
1176082023 20:63278279-63278301 ACTGCACATGGGAGGCCCCAAGG - Intronic
1176148960 20:63579176-63579198 AGAGCAGCTGGGAGGCCCCGGGG - Intergenic
1178639632 21:34335609-34335631 TGGGCACTTTGGAGCCCACGTGG - Intergenic
1178680497 21:34669522-34669544 AGGGCGCAGAGGAGGCGCCGAGG + Exonic
1180038530 21:45263729-45263751 AGGCCACACTGGGGGCCCAGGGG + Intergenic
1181431731 22:22885469-22885491 AGGGCACAAGGGAGGGCCCTGGG - Intronic
1182484291 22:30630092-30630114 AGGGCACATGGGAGGGGCTGTGG - Intergenic
1183736683 22:39648423-39648445 AGGGCAGAGGGGAGGCCCAGGGG - Intronic
1184524683 22:45014882-45014904 AAGGCACAGTGGAGGCTCCGAGG + Intergenic
1185040447 22:48501279-48501301 TGGGCACACTGAAGGCCTCGGGG - Intronic
1185298772 22:50068229-50068251 AGGGCGGAATCGAGGCCCCGAGG + Intronic
949940157 3:9148623-9148645 ATTGTAAATTGGAGGCCCCGTGG - Intronic
950546695 3:13642311-13642333 AGGGCCCATTGGTGGCCTCCTGG + Intergenic
953086274 3:39671077-39671099 AGGCCAAATTGAAGGCCCTGTGG - Intergenic
953705195 3:45225729-45225751 AGGTCGCACTGGAAGCCCCGCGG + Exonic
956779163 3:72590870-72590892 AGAGCACAGCGGAGGCCCCGGGG + Intergenic
960084475 3:113575905-113575927 AGGGCACATTGGAGGGGCAGGGG + Intronic
961302551 3:125931505-125931527 AGCACACACTGGAGGCCACGAGG - Intronic
961885920 3:130096275-130096297 AGCACACACTGGAGGCCACGAGG + Intronic
967553824 3:190831488-190831510 AGGGGCCAGTGGAGGCCCAGTGG - Intergenic
967891038 3:194364855-194364877 GGAGCACTTTGGAGGCCCTGTGG - Intronic
968663963 4:1810658-1810680 AGGGGTCAAGGGAGGCCCCGAGG + Intergenic
969115302 4:4867359-4867381 ACGGAACCTTGGAGGCCGCGCGG - Intergenic
969116310 4:4872674-4872696 AGCTCCCCTTGGAGGCCCCGAGG - Intergenic
969122508 4:4920449-4920471 AGGGGACATTGGGGGACCCTGGG + Intergenic
969758880 4:9168370-9168392 AGCACACACTGGAGGCCACGAGG - Intergenic
977842866 4:101730147-101730169 AGGGCATATGGAAGGCCCAGAGG - Intronic
980564330 4:134518889-134518911 AGGGCACTTTGGTGGGCACGGGG - Intergenic
980969524 4:139555986-139556008 AGGGGACAGTGGCGGCCGCGGGG + Intronic
987297420 5:16566060-16566082 AGGGGACAATGAAGTCCCCGAGG - Intronic
991096368 5:62744128-62744150 AGGGCATATTCAAGGCCCCTGGG + Intergenic
992788448 5:80192116-80192138 AGTACACACTGGAGGCCCTGTGG - Intronic
997965362 5:138352506-138352528 AGGGGGCACTGCAGGCCCCGGGG + Intergenic
998177550 5:139911218-139911240 AGGGCACACAGCAGGCCCCGGGG - Intronic
999691601 5:154150865-154150887 AAAGCACATTGGAGGTCCCTGGG + Intronic
1000393010 5:160744947-160744969 AGGGAAGATTGCAGGCCCTGGGG + Intronic
1020319369 7:6928745-6928767 AGCACACACTGGAGGCCACGAGG + Intergenic
1022385457 7:29894706-29894728 AGGGCACATAGGAGACCACAGGG - Intronic
1023869859 7:44257347-44257369 AGGTGTCATTGGAGGCCCTGAGG - Intronic
1026969594 7:74459898-74459920 AGGGCTCAGTGGAGGCCCCGGGG + Intronic
1029179065 7:98686158-98686180 AGGGCAAGTTGGAGGCCTGGAGG - Intergenic
1029915784 7:104208258-104208280 AGGGGTCATTGGAGGCCCACGGG - Intergenic
1030846409 7:114418826-114418848 AAGGCAGATTGGAGGCACCTGGG - Intronic
1032781840 7:135170304-135170326 TGGGCAGAATGGGGGCCCCGCGG + Intronic
1034545064 7:151784202-151784224 AGGCCACATGGGAGGACCGGAGG + Intronic
1035657136 8:1318803-1318825 GGAACACATTGGAGGCCCCAAGG - Intergenic
1036847626 8:12180591-12180613 AGCACACACTGGAGGCCACGAGG + Intergenic
1040119360 8:43664731-43664753 AGGGGACATTTGAGAGCCCGTGG + Intergenic
1044873978 8:96645791-96645813 AAGGCATATTGGAGGCTCAGGGG - Intronic
1049176319 8:141194705-141194727 AGGCCTCGCTGGAGGCCCCGGGG - Exonic
1049409454 8:142465973-142465995 AGAGCCCTGTGGAGGCCCCGTGG + Intronic
1051553173 9:18353139-18353161 AGGGCACAAGGGAGGCCCTGAGG + Intergenic
1053430457 9:38038764-38038786 TGGGCATCTAGGAGGCCCCGGGG + Intronic
1055554294 9:77459814-77459836 AAGGCACTTTCTAGGCCCCGTGG - Intronic
1056432319 9:86540159-86540181 AGGGCACATTTGAGACTCAGTGG - Intergenic
1059428388 9:114235555-114235577 AGGTTACAATGGAGGCCACGTGG - Intronic
1061374132 9:130214201-130214223 GGGGCACAGAGGAGGCCCGGAGG + Intronic
1061932592 9:133840895-133840917 GGGGCACATTGGACGCGCAGGGG + Intronic
1062005179 9:134235335-134235357 AGGGCACAGTGGAGGCAGCAGGG - Intergenic
1062008050 9:134251452-134251474 GGGGCTCACAGGAGGCCCCGGGG - Intergenic
1062101701 9:134731812-134731834 AGAGCAAATTCGAGGCACCGAGG - Intronic
1062267951 9:135695947-135695969 AGGGCAGATGGGGCGCCCCGGGG + Intronic
1062352608 9:136146440-136146462 GGGGCCCATTGGAGGCTCCAGGG - Intergenic
1062732040 9:138115497-138115519 AGGCCACATTGCAGGCCCATTGG + Intronic
1186766783 X:12778662-12778684 AGGGGACATTGGTGGCCCTATGG + Intergenic
1196746188 X:119073369-119073391 AGGGCCCATGAGAGGCCTCGGGG + Intergenic