ID: 1160684462

View in Genome Browser
Species Human (GRCh38)
Location 19:427053-427075
Sequence CGCACGTTCCTCTGGGATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160684462_1160684473 10 Left 1160684462 19:427053-427075 CCAGCATCCCAGAGGAACGTGCG No data
Right 1160684473 19:427086-427108 AGCACAGCTGGGCACCGGGTGGG No data
1160684462_1160684472 9 Left 1160684462 19:427053-427075 CCAGCATCCCAGAGGAACGTGCG No data
Right 1160684472 19:427085-427107 GAGCACAGCTGGGCACCGGGTGG No data
1160684462_1160684474 20 Left 1160684462 19:427053-427075 CCAGCATCCCAGAGGAACGTGCG No data
Right 1160684474 19:427096-427118 GGCACCGGGTGGGCACTCGATGG No data
1160684462_1160684467 -1 Left 1160684462 19:427053-427075 CCAGCATCCCAGAGGAACGTGCG No data
Right 1160684467 19:427075-427097 GCCAGGACCAGAGCACAGCTGGG No data
1160684462_1160684469 5 Left 1160684462 19:427053-427075 CCAGCATCCCAGAGGAACGTGCG No data
Right 1160684469 19:427081-427103 ACCAGAGCACAGCTGGGCACCGG No data
1160684462_1160684466 -2 Left 1160684462 19:427053-427075 CCAGCATCCCAGAGGAACGTGCG No data
Right 1160684466 19:427074-427096 CGCCAGGACCAGAGCACAGCTGG No data
1160684462_1160684471 6 Left 1160684462 19:427053-427075 CCAGCATCCCAGAGGAACGTGCG No data
Right 1160684471 19:427082-427104 CCAGAGCACAGCTGGGCACCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160684462 Original CRISPR CGCACGTTCCTCTGGGATGC TGG (reversed) Intronic