ID: 1160684464

View in Genome Browser
Species Human (GRCh38)
Location 19:427060-427082
Sequence GTCCTGGCGCACGTTCCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160684464_1160684469 -2 Left 1160684464 19:427060-427082 CCCAGAGGAACGTGCGCCAGGAC No data
Right 1160684469 19:427081-427103 ACCAGAGCACAGCTGGGCACCGG No data
1160684464_1160684473 3 Left 1160684464 19:427060-427082 CCCAGAGGAACGTGCGCCAGGAC No data
Right 1160684473 19:427086-427108 AGCACAGCTGGGCACCGGGTGGG No data
1160684464_1160684466 -9 Left 1160684464 19:427060-427082 CCCAGAGGAACGTGCGCCAGGAC No data
Right 1160684466 19:427074-427096 CGCCAGGACCAGAGCACAGCTGG No data
1160684464_1160684472 2 Left 1160684464 19:427060-427082 CCCAGAGGAACGTGCGCCAGGAC No data
Right 1160684472 19:427085-427107 GAGCACAGCTGGGCACCGGGTGG No data
1160684464_1160684467 -8 Left 1160684464 19:427060-427082 CCCAGAGGAACGTGCGCCAGGAC No data
Right 1160684467 19:427075-427097 GCCAGGACCAGAGCACAGCTGGG No data
1160684464_1160684474 13 Left 1160684464 19:427060-427082 CCCAGAGGAACGTGCGCCAGGAC No data
Right 1160684474 19:427096-427118 GGCACCGGGTGGGCACTCGATGG No data
1160684464_1160684471 -1 Left 1160684464 19:427060-427082 CCCAGAGGAACGTGCGCCAGGAC No data
Right 1160684471 19:427082-427104 CCAGAGCACAGCTGGGCACCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160684464 Original CRISPR GTCCTGGCGCACGTTCCTCT GGG (reversed) Intronic