ID: 1160684468

View in Genome Browser
Species Human (GRCh38)
Location 19:427076-427098
Sequence GCCCAGCTGTGCTCTGGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160684468_1160684476 23 Left 1160684468 19:427076-427098 CCAGGACCAGAGCACAGCTGGGC No data
Right 1160684476 19:427122-427144 GAGTTTCTCTGACCAGCTCGAGG No data
1160684468_1160684474 -3 Left 1160684468 19:427076-427098 CCAGGACCAGAGCACAGCTGGGC No data
Right 1160684474 19:427096-427118 GGCACCGGGTGGGCACTCGATGG No data
1160684468_1160684477 24 Left 1160684468 19:427076-427098 CCAGGACCAGAGCACAGCTGGGC No data
Right 1160684477 19:427123-427145 AGTTTCTCTGACCAGCTCGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160684468 Original CRISPR GCCCAGCTGTGCTCTGGTCC TGG (reversed) Intronic