ID: 1160684474

View in Genome Browser
Species Human (GRCh38)
Location 19:427096-427118
Sequence GGCACCGGGTGGGCACTCGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160684464_1160684474 13 Left 1160684464 19:427060-427082 CCCAGAGGAACGTGCGCCAGGAC No data
Right 1160684474 19:427096-427118 GGCACCGGGTGGGCACTCGATGG No data
1160684465_1160684474 12 Left 1160684465 19:427061-427083 CCAGAGGAACGTGCGCCAGGACC No data
Right 1160684474 19:427096-427118 GGCACCGGGTGGGCACTCGATGG No data
1160684470_1160684474 -9 Left 1160684470 19:427082-427104 CCAGAGCACAGCTGGGCACCGGG No data
Right 1160684474 19:427096-427118 GGCACCGGGTGGGCACTCGATGG No data
1160684468_1160684474 -3 Left 1160684468 19:427076-427098 CCAGGACCAGAGCACAGCTGGGC No data
Right 1160684474 19:427096-427118 GGCACCGGGTGGGCACTCGATGG No data
1160684462_1160684474 20 Left 1160684462 19:427053-427075 CCAGCATCCCAGAGGAACGTGCG No data
Right 1160684474 19:427096-427118 GGCACCGGGTGGGCACTCGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160684474 Original CRISPR GGCACCGGGTGGGCACTCGA TGG Intronic