ID: 1160686349

View in Genome Browser
Species Human (GRCh38)
Location 19:438685-438707
Sequence TCTGGGGACGCCAGGCGAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 220}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160686326_1160686349 29 Left 1160686326 19:438633-438655 CCCCAGCACCCCACCTGGCTTTG 0: 1
1: 0
2: 5
3: 45
4: 463
Right 1160686349 19:438685-438707 TCTGGGGACGCCAGGCGAAGAGG 0: 1
1: 0
2: 0
3: 16
4: 220
1160686333_1160686349 16 Left 1160686333 19:438646-438668 CCTGGCTTTGCCTCCTAGGACTC 0: 1
1: 0
2: 0
3: 25
4: 245
Right 1160686349 19:438685-438707 TCTGGGGACGCCAGGCGAAGAGG 0: 1
1: 0
2: 0
3: 16
4: 220
1160686332_1160686349 19 Left 1160686332 19:438643-438665 CCACCTGGCTTTGCCTCCTAGGA 0: 1
1: 0
2: 2
3: 70
4: 1115
Right 1160686349 19:438685-438707 TCTGGGGACGCCAGGCGAAGAGG 0: 1
1: 0
2: 0
3: 16
4: 220
1160686335_1160686349 6 Left 1160686335 19:438656-438678 CCTCCTAGGACTCCTGGCCCCTC 0: 1
1: 0
2: 1
3: 33
4: 360
Right 1160686349 19:438685-438707 TCTGGGGACGCCAGGCGAAGAGG 0: 1
1: 0
2: 0
3: 16
4: 220
1160686336_1160686349 3 Left 1160686336 19:438659-438681 CCTAGGACTCCTGGCCCCTCTGG 0: 1
1: 0
2: 4
3: 44
4: 379
Right 1160686349 19:438685-438707 TCTGGGGACGCCAGGCGAAGAGG 0: 1
1: 0
2: 0
3: 16
4: 220
1160686342_1160686349 -6 Left 1160686342 19:438668-438690 CCTGGCCCCTCTGGGGGTCTGGG 0: 1
1: 0
2: 1
3: 53
4: 450
Right 1160686349 19:438685-438707 TCTGGGGACGCCAGGCGAAGAGG 0: 1
1: 0
2: 0
3: 16
4: 220
1160686328_1160686349 27 Left 1160686328 19:438635-438657 CCAGCACCCCACCTGGCTTTGCC 0: 1
1: 0
2: 2
3: 59
4: 435
Right 1160686349 19:438685-438707 TCTGGGGACGCCAGGCGAAGAGG 0: 1
1: 0
2: 0
3: 16
4: 220
1160686327_1160686349 28 Left 1160686327 19:438634-438656 CCCAGCACCCCACCTGGCTTTGC 0: 1
1: 0
2: 3
3: 29
4: 315
Right 1160686349 19:438685-438707 TCTGGGGACGCCAGGCGAAGAGG 0: 1
1: 0
2: 0
3: 16
4: 220
1160686325_1160686349 30 Left 1160686325 19:438632-438654 CCCCCAGCACCCCACCTGGCTTT 0: 1
1: 0
2: 5
3: 57
4: 473
Right 1160686349 19:438685-438707 TCTGGGGACGCCAGGCGAAGAGG 0: 1
1: 0
2: 0
3: 16
4: 220
1160686330_1160686349 20 Left 1160686330 19:438642-438664 CCCACCTGGCTTTGCCTCCTAGG 0: 1
1: 0
2: 1
3: 28
4: 288
Right 1160686349 19:438685-438707 TCTGGGGACGCCAGGCGAAGAGG 0: 1
1: 0
2: 0
3: 16
4: 220
1160686329_1160686349 21 Left 1160686329 19:438641-438663 CCCCACCTGGCTTTGCCTCCTAG 0: 1
1: 0
2: 4
3: 32
4: 355
Right 1160686349 19:438685-438707 TCTGGGGACGCCAGGCGAAGAGG 0: 1
1: 0
2: 0
3: 16
4: 220

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160686349 Original CRISPR TCTGGGGACGCCAGGCGAAG AGG Intronic
900552723 1:3264672-3264694 TCTGAGGACCCCAGGCCAGGAGG + Intronic
902733641 1:18385816-18385838 TCTGGGAACTCCAGGCCCAGTGG - Intergenic
903269521 1:22178653-22178675 TCAGAGGACAGCAGGCGAAGAGG - Intergenic
903341015 1:22654316-22654338 CCTGGGGAAGCCAGGGGCAGGGG - Intronic
903448281 1:23436448-23436470 TCTGGGGAGGCTGGGCGCAGTGG - Intronic
903855424 1:26335187-26335209 ACTGGGGTCGCCGGGCGCAGTGG + Intronic
903864681 1:26389574-26389596 TCAGGGAACGCCAGGGGTAGAGG - Intergenic
904136793 1:28318929-28318951 TCTGGGTAGGCCGGGCGCAGTGG + Intergenic
905673783 1:39810925-39810947 TTTGGGGAGGCCAGGCACAGTGG + Intergenic
907498414 1:54860696-54860718 TTTGGTGAGGCCAGGCGCAGTGG + Intronic
912842036 1:113047332-113047354 TCTGGGGAGGCCAAGGGAAAAGG + Intergenic
915118114 1:153612875-153612897 TATTGGGAGGCCAGGAGAAGGGG - Intronic
915168664 1:153963001-153963023 TCTGGGGGCACCAGGTGAAAGGG - Exonic
915536094 1:156536464-156536486 TCTGGGGAGGGTAGGAGAAGGGG + Intronic
915544549 1:156589324-156589346 TATGGGGAGGCCAGTCGCAGGGG + Intergenic
915568702 1:156732083-156732105 GCTGGGGATGCCTGGGGAAGGGG + Exonic
919766600 1:201131575-201131597 TCTGGGAGCGCCAGGCCCAGAGG - Intergenic
919975189 1:202605789-202605811 GCTGGGGACGAGAGGTGAAGAGG + Exonic
920200520 1:204257305-204257327 TCTGGGGACCTCAGGGGATGAGG + Intronic
922217903 1:223535577-223535599 TCTGAGGATGCCAGGCTCAGGGG - Intergenic
924466226 1:244301460-244301482 TCTAGGGAGGCCAGGCGCGGTGG + Intergenic
1063010950 10:2020929-2020951 TCTGGGGACACCAGGCAGAATGG - Intergenic
1064977432 10:21133336-21133358 TCTTGGGAGGCCAGGCTTAGCGG + Intronic
1065861797 10:29878157-29878179 TCTGGGGAGACCAGGCGCTGAGG - Intergenic
1066393646 10:34998592-34998614 TCTGGGGAGGCCAAGCTGAGAGG + Intergenic
1068954747 10:62812936-62812958 TGTGGGGACCCCTGGCCAAGAGG - Exonic
1070159363 10:73856508-73856530 CCTGGAGCTGCCAGGCGAAGAGG + Intronic
1071142223 10:82522330-82522352 TCAGTGGAGGCCAGGCGCAGTGG - Intronic
1071142263 10:82522924-82522946 TCTGGGGATGACAGGGGATGGGG - Intronic
1071404574 10:85317810-85317832 TCTGGGGAAGTCAAGGGAAGAGG + Intergenic
1072739863 10:97902823-97902845 TCTGGGGAGGCCAGGGAAAGAGG + Intronic
1073195166 10:101684411-101684433 GCTGGGTAGGCCAGGCGCAGTGG - Intronic
1073441547 10:103555463-103555485 CCTGGGGAGGCCGGGCGGAGGGG + Intronic
1073541934 10:104322017-104322039 TCTGGGGACTCCATACGTAGTGG - Intronic
1076155111 10:128198368-128198390 TCTGGGGAGTCCAGGCGTGGTGG - Intergenic
1076683591 10:132187115-132187137 GCAGGGGGCGCCGGGCGAAGCGG - Intronic
1077194715 11:1273613-1273635 GATGGGGACGCCCGGCGATGGGG + Intergenic
1077194721 11:1273629-1273651 GATGGGGACGCCCGGCGATGGGG + Intergenic
1078104655 11:8351058-8351080 TCTGGGGACCCCAGGAGAGGAGG - Intergenic
1078437981 11:11341103-11341125 TCTGGGGAGTCAAGGTGAAGGGG - Intronic
1083487499 11:62992941-62992963 TCAGGGGACCTCAGGGGAAGAGG + Exonic
1083603838 11:63965157-63965179 GGTGGGGACCCCAGGGGAAGAGG - Intergenic
1084157943 11:67325474-67325496 ACTGGGCACGCCAGGCGCGGTGG + Intronic
1084572717 11:69969215-69969237 TTTGGGGACAGCAGGAGAAGGGG - Intergenic
1084836327 11:71804340-71804362 TCTGGGGCCACCTGGCTAAGAGG + Intergenic
1084857332 11:71997623-71997645 CCTGGGGACCCCAGGGAAAGAGG - Intergenic
1085474903 11:76783498-76783520 GCTGGGGACGCCGGGCGCAGGGG + Intronic
1085508651 11:77074309-77074331 GCTGGGGATGCCAGGCAGAGGGG - Intronic
1086934288 11:92727871-92727893 TCTGGGGAGGCCAGCCTCAGTGG - Intronic
1087328571 11:96752972-96752994 TCTGGGAACGCCATCCCAAGGGG + Intergenic
1087681893 11:101228031-101228053 GCTGGGGAGGCCGGGCGCAGTGG + Intergenic
1087873818 11:103331772-103331794 TCTGATGAGGCCAGGCGCAGTGG + Intronic
1089123617 11:116160603-116160625 TTTGGTGAGGCCAGGCGCAGTGG - Intergenic
1089382311 11:118043837-118043859 TATGGGGGGGCCAGGGGAAGTGG + Intergenic
1090092367 11:123709715-123709737 TCAGAGGAGGCCAGGCGCAGTGG - Intergenic
1091439983 12:505177-505199 TCTGGTGAGGCCAGGCGTGGTGG - Intronic
1092019667 12:5190736-5190758 TCTGGAGAAGCCAGGTGCAGTGG - Intergenic
1092139294 12:6171821-6171843 TCTGGGGCGGCGAGGGGAAGCGG - Intergenic
1093165525 12:15801330-15801352 TCTGAGGAGGCCGGGCGCAGTGG + Intronic
1096716369 12:53493811-53493833 TCTGGGGAAGCCTGGTGAACTGG - Exonic
1097013766 12:55971109-55971131 TCTGGGGACCCCAGATGAGGTGG + Exonic
1097082953 12:56446541-56446563 TCTGTGCAGGCCAGGCGCAGTGG + Intronic
1100937483 12:99685965-99685987 TTTGGGGACTCCAGGGTAAGGGG + Intronic
1104524603 12:129507692-129507714 TCTGGGGACTCAAGGGGAAAGGG + Intronic
1106152511 13:27119379-27119401 TCTGAGGACAGCAGGCCAAGAGG + Intronic
1107108700 13:36673779-36673801 TCTGGGGAAGGCAGGTGTAGTGG - Intergenic
1107483355 13:40803474-40803496 TATGGGGAGGCCAGGCGTGGTGG - Intronic
1107837127 13:44421159-44421181 AGTGGGGACGCCAGGCCTAGCGG - Intergenic
1108299983 13:49064053-49064075 TCTGTGGAGGCCAGGCGTGGTGG + Intronic
1108623920 13:52209552-52209574 TCTGGGCAGGCCGGGCGCAGTGG + Intergenic
1110981948 13:81911444-81911466 TGTGGAGAAGCCAAGCGAAGAGG + Intergenic
1112091806 13:96090832-96090854 TCTCAGGCCGGCAGGCGAAGCGG - Exonic
1113657570 13:112077987-112078009 CCTGGGGAGGCCAGGTGATGAGG - Intergenic
1114460735 14:22884740-22884762 TCTGGGGGCCCCAGGGGCAGAGG - Exonic
1114460739 14:22884748-22884770 CCTGGGGCCCCCAGACGAAGAGG + Exonic
1114555558 14:23560204-23560226 CCTGGGGACTCCAGGAGAAAAGG - Exonic
1120917405 14:89722082-89722104 TCTGGGGACAGCAGGAGGAGAGG + Intergenic
1121491027 14:94361366-94361388 CCTGGGGAGGGCAGGAGAAGGGG + Intergenic
1121492418 14:94369847-94369869 CCTGGGGAAGGCAGGAGAAGGGG + Intergenic
1121578259 14:95006656-95006678 TCTGGGGACAGCAGGAGAGGAGG + Intergenic
1123066223 14:105620827-105620849 TCTGGGGGCACCAGGTGGAGAGG - Intergenic
1123070364 14:105639879-105639901 TCTGGGGGCACCAGGTGGAGAGG - Intergenic
1123074956 14:105663539-105663561 TCTGGGGGCACCAGGTGGAGAGG - Intergenic
1123089600 14:105736667-105736689 TCTGGGGGCACCAGGTGGAGAGG - Intergenic
1123095393 14:105764827-105764849 TCTGGGGGCACCAGGTGGAGAGG - Intergenic
1124226134 15:27896901-27896923 TCTTGGCAGGCCAGGCGCAGTGG + Intronic
1124931237 15:34121624-34121646 ACTGGGGAGGCCAGGTGCAGTGG - Intergenic
1128308809 15:66617733-66617755 TCTGGGGCCGCCTGGCCAGGAGG - Intronic
1129042224 15:72698387-72698409 TCTGGGGAGGCAAGGGGATGTGG - Intronic
1129342066 15:74892637-74892659 TGTGGGGTGGCCAGGGGAAGAGG - Intronic
1129522631 15:76195521-76195543 CCTTAGGAAGCCAGGCGAAGTGG - Intronic
1132301790 15:100780593-100780615 TGTGGGCACGCCAGGCAGAGGGG - Intergenic
1132466058 16:77938-77960 TCTGGGGCCGCCAGGCGACCAGG + Intronic
1132543309 16:521506-521528 TCTGGGGCCTCCAGGCCATGTGG + Exonic
1133294330 16:4743536-4743558 AATGGGGAGGCCAGGGGAAGCGG - Intronic
1136055432 16:27685097-27685119 TTTGAGGAGGCCAGGCGCAGTGG + Intronic
1136391705 16:29969480-29969502 AATGGGGTCGCCAGGCGCAGTGG - Intronic
1136456479 16:30382460-30382482 TCTGGGGACCCCAGGCATGGGGG + Intronic
1138124729 16:54429416-54429438 TGTGGGGATGCCAGGTGGAGAGG + Intergenic
1140330168 16:74048953-74048975 TCTGTTGAGGCCAGGCGCAGTGG - Intergenic
1142010224 16:87710050-87710072 GCTGGGGAAGCCAGGCTGAGGGG + Intronic
1142903968 17:3030830-3030852 GCTAGGGAGGCCAGGGGAAGGGG - Intronic
1143086224 17:4417972-4417994 TCAGGAGAGCCCAGGCGAAGAGG + Intergenic
1143172594 17:4938797-4938819 TGTGGGAACACCAGCCGAAGTGG - Exonic
1143470902 17:7174460-7174482 TCTGGGGAGACCGGGCGGAGGGG + Exonic
1143650698 17:8262869-8262891 ACTGGGGAAGCCACGAGAAGAGG - Intronic
1145013430 17:19382365-19382387 TCTGGGGGCGGCAGGCCAGGTGG - Exonic
1146180994 17:30698019-30698041 TCTGCGGCCGCCAGGTGAGGGGG - Intergenic
1146427049 17:32750324-32750346 CCTGGGGAGGCCAGGCGTGGTGG + Intronic
1146486584 17:33248045-33248067 AATGGGGATGCCAGGGGAAGAGG + Intronic
1146521178 17:33526760-33526782 TCTGGGGAGGGGAGGAGAAGGGG - Intronic
1146787169 17:35730785-35730807 TCTGCGGAGGGCAGGGGAAGTGG - Intronic
1148333078 17:46823725-46823747 TCTGGGGAGGCCAGGCATGGTGG - Intronic
1149038186 17:52158176-52158198 TCTTGGGGCGCCAGACGAATCGG - Exonic
1149678720 17:58488539-58488561 TCTGGGAACGCCTGGGGAAGGGG - Intergenic
1160182453 18:76647516-76647538 TCTGGGCACGCCATCCGAGGGGG + Intergenic
1160686349 19:438685-438707 TCTGGGGACGCCAGGCGAAGAGG + Intronic
1161485256 19:4532015-4532037 TCTGTGTACGCCATGGGAAGAGG - Intronic
1161913533 19:7212327-7212349 TGTGGGGAAGCCAGGGGAATGGG - Intronic
1162028340 19:7906466-7906488 TCTGGGGAGGCCAGGCACGGTGG + Intronic
1162977604 19:14217560-14217582 TCTGCGGCCGCCAGGTGAGGGGG + Intergenic
1163424505 19:17233935-17233957 TCTGGGAAGGCCAGGCGCGGTGG + Intronic
1164062940 19:21691137-21691159 TCTGGGGTCGATAGGCGAAATGG + Intergenic
1165821809 19:38681485-38681507 TTTGGGGACCCCAGGAGAAGTGG - Intronic
1165907610 19:39203455-39203477 TCTGGGGACTCCAGGGTGAGGGG + Intronic
1167850735 19:52199454-52199476 TGTGGGGAGGCCAGGCGCAGTGG - Intronic
926801898 2:16666096-16666118 TCTGGGAAGGCAAGGCCAAGTGG - Intronic
930707578 2:54519904-54519926 TCTGGGGCGGCTAGGAGAAGTGG + Intronic
932776131 2:74529499-74529521 CCTGGGGGCGAGAGGCGAAGTGG + Exonic
934986647 2:98892401-98892423 TCTGAGCAGGCCAGGCGTAGTGG + Intronic
937292302 2:120788952-120788974 TCTGGGGAGGGCAGGCTAGGAGG - Intronic
938244066 2:129763871-129763893 TTTGGGGACTCCAGGGGGAGGGG - Intergenic
940517288 2:154698086-154698108 TCGGGGGACGCCAGGCGGACAGG + Intergenic
941853739 2:170209260-170209282 TCTGGGGAAGCCAGGCAGAGAGG + Intronic
942045257 2:172096052-172096074 TCGGGGGACGCCAGGAGTGGGGG + Intergenic
942046689 2:172103000-172103022 TCCGGGAACGCCCGGCCAAGGGG + Intergenic
942671237 2:178378114-178378136 TCAGAGGAGGCCAGGCGCAGTGG - Intronic
943901073 2:193437322-193437344 TCTTTGGAGGCCAGGCGCAGTGG - Intergenic
947823481 2:233088766-233088788 GCTGGGGACACCAGGCACAGGGG + Intronic
948752500 2:240140591-240140613 TCTGGAGAGGCCAGGCAGAGTGG - Intronic
1169016678 20:2298298-2298320 TCTGGGGATGCCAGGCCACTTGG - Intronic
1169171698 20:3470786-3470808 GCCGGGGACGAAAGGCGAAGGGG + Intergenic
1169374848 20:5058260-5058282 ACAGGGGACGCCAGGCACAGTGG - Intergenic
1170592771 20:17783516-17783538 TCTGGTGAGGCCAGGAGGAGTGG - Intergenic
1170782586 20:19438842-19438864 TGTGGGGATGCCAGGTGCAGAGG - Intronic
1171964684 20:31520589-31520611 TCTGGAGAAGCCAGGCACAGTGG - Intronic
1172053898 20:32140853-32140875 TCTGGGGAGGCCAGGAGCATGGG + Intronic
1172666538 20:36604414-36604436 CCTAGGGAGGCCAGGCGCAGTGG - Intronic
1173328651 20:42055881-42055903 TCTGGGGAGGCCAGCTGATGGGG + Intergenic
1173995667 20:47336891-47336913 TCTGGGGATGCAGGGGGAAGGGG - Intronic
1175733198 20:61368154-61368176 TCTGGAGAGGCCGGGCGCAGCGG - Intronic
1175755990 20:61530531-61530553 TCTGGGGGAGCCAGGGGAAGAGG - Intronic
1175802834 20:61810847-61810869 TCTGGAGAAGCCGGGCCAAGGGG - Intronic
1183314501 22:37129462-37129484 TCTGGGGATGGGAGGCGGAGGGG - Intronic
1183501288 22:38181190-38181212 TCTGGGGTGGCCAGGCTGAGGGG + Intronic
1183937918 22:41274453-41274475 CCTGGGGAGGCCAGAGGAAGAGG + Intronic
1184036836 22:41922424-41922446 TCTGGGGACCACAGGCCAGGAGG + Intergenic
1184439505 22:44500217-44500239 TCTGGGGTCCCCTGGCCAAGAGG - Intergenic
1185385236 22:50528871-50528893 TCTGGGGACCCAAGGGGAAAGGG + Intronic
949522841 3:4872430-4872452 CCTGGGGAGGCCAGGCGTGGTGG + Intronic
951508817 3:23479465-23479487 TCTGGGGAGCCCAGGCCTAGGGG - Intronic
954118439 3:48480188-48480210 TCTGTGGAGGCCAGGCGTGGTGG - Intronic
954379837 3:50213531-50213553 GCTGGGAACGGCAGGCGCAGAGG - Intronic
955318646 3:57959022-57959044 TGTGGGGGCGCCATGAGAAGGGG + Intergenic
957344333 3:78942748-78942770 CCTGGGGAAGCCAGGCCCAGTGG + Intronic
968024657 3:195430424-195430446 TATGGGGAGGCCAGGAGCAGTGG + Intronic
969688466 4:8690025-8690047 CCTGGGGACACCAGGCAAACAGG + Intergenic
970368034 4:15380645-15380667 TATGGGGAGGCCAGGCACAGTGG + Intronic
970776701 4:19682959-19682981 TTTGGGGAGGCCAGGTGCAGTGG - Intergenic
971847385 4:31937009-31937031 TCTGGGGACTCCAGGTGGGGAGG + Intergenic
974251035 4:59383037-59383059 TTTGGGGACTCCAGGAGAAAAGG - Intergenic
978119369 4:105060101-105060123 TCTGGGGCAGCCGGGCGCAGTGG + Intergenic
979509496 4:121536243-121536265 TCTGTGCAAGCCAAGCGAAGAGG + Intergenic
981034068 4:140152443-140152465 TCTGGGGAGGCGAGGCGGCGCGG + Intronic
984140840 4:176002170-176002192 GCGGGGGACGCCAGGCGCGGGGG + Intronic
984623575 4:181980057-181980079 TCTGGGGCCTGCAGGCAAAGTGG - Intergenic
984708309 4:182863789-182863811 TCTGTGGAGCCCAGGAGAAGGGG - Intergenic
988361138 5:30238281-30238303 TCTGGAGAAGCCAGGTGGAGAGG - Intergenic
988718542 5:33853016-33853038 CCTGGGGACGGCAGGGGTAGGGG - Intronic
992754948 5:79895430-79895452 TCTGGGGTCCCCTGGCCAAGGGG + Intergenic
997456439 5:134020868-134020890 TCTGGGGAGGCCAGTCACAGGGG + Intergenic
999759337 5:154688370-154688392 GCTGGGCAGGCCAGGCGAGGTGG + Intergenic
1005292124 6:24390053-24390075 TTTGGGGAGGCCAGGTGCAGTGG + Intergenic
1006291951 6:33144869-33144891 TCTGGGAACGCCAGGAGTAATGG - Intergenic
1006296870 6:33173659-33173681 CCTGGGGACCTCAGGGGAAGGGG + Intronic
1006629423 6:35420442-35420464 TCTGGGCACTGCAGGAGAAGAGG + Intronic
1009588701 6:65638458-65638480 TTTGGGGACGCCAGACCTAGGGG + Intronic
1010391165 6:75339658-75339680 TGTGGGGAGGCCAGGCGCAGTGG + Intronic
1013082053 6:106821626-106821648 TCTGGGGAGGCGGGGAGAAGGGG - Intergenic
1018597762 6:165501272-165501294 TCTGAGGAGGCCAGGCGCAGTGG + Intronic
1018842289 6:167526183-167526205 TCTGGGGACTCCAGGAGGAAAGG - Intergenic
1019325437 7:436124-436146 TCTGGGGTCTCGAGGGGAAGAGG + Intergenic
1019648691 7:2144620-2144642 GCTGGGGACGCCAGGCAGAGGGG + Intronic
1019667498 7:2259157-2259179 TCTGGGGAAGGCAGCGGAAGCGG + Intronic
1019706028 7:2497773-2497795 TCTGGGGCCACCAGGCGCACAGG + Intergenic
1022098747 7:27156891-27156913 TCTGCGGACGCCAGGCGGCCCGG + Intronic
1023578821 7:41659428-41659450 TCTGGGGACCCCAGGGGAGGTGG + Intergenic
1026573713 7:71554506-71554528 CCTGAGTACCCCAGGCGAAGGGG - Intronic
1029200263 7:98834710-98834732 CCTGGGGAGGCGAGGGGAAGTGG + Intergenic
1029575330 7:101399890-101399912 TCTGGGAAGGCCAGGGGCAGCGG - Intronic
1029599845 7:101557366-101557388 TCTGGGGAGGCCAGGGGATCTGG - Exonic
1031496983 7:122461879-122461901 TCTTGGCAGGCCAGGCGAGGTGG - Intronic
1033732115 7:144190089-144190111 TCAGGGGAGGCCAGGTGCAGTGG - Intronic
1033742964 7:144288674-144288696 TCAGGGGAGGCCAGGTGCAGTGG - Intergenic
1037919075 8:22791176-22791198 TCTGGGGGTGCAAGGGGAAGGGG + Intronic
1039046973 8:33459351-33459373 CCTGTGGAAGCCAGGCGCAGTGG + Intronic
1039588669 8:38728650-38728672 TCTGGGGACCCTCGCCGAAGAGG + Intronic
1041438467 8:57867593-57867615 TCTGTGGAGGCCAGGCGTGGTGG - Intergenic
1042917005 8:73885303-73885325 TCTGGGCAGGCCAGGCGCGGTGG + Intergenic
1043300846 8:78729590-78729612 TCTGGGGATGCCAGGCAAGAAGG + Intronic
1046973084 8:120244542-120244564 TTTGGGGACTCCAGGGGAAAGGG - Intronic
1049091119 8:140514191-140514213 ACTGGGGAGGCCAGGCGTGGTGG - Intronic
1049293387 8:141816236-141816258 TCTGAGGACGCCATGCGGAATGG - Intergenic
1049808883 8:144554316-144554338 TCTGGGGATGTCAGGAGTAGGGG - Intronic
1049838428 8:144754996-144755018 TCCAGGGACGCCCGGCTAAGGGG + Intronic
1053137865 9:35662956-35662978 TCAGTGGACGCCAGGCAAAGGGG - Exonic
1056069809 9:82974310-82974332 TTTGTGGAGGCCAGGCGCAGTGG - Intergenic
1056147382 9:83746076-83746098 TGGGGGGAGGCCAGGCGCAGTGG - Intronic
1057956993 9:99418081-99418103 TTTGGGGAGGCCAGGCACAGTGG + Intergenic
1058816824 9:108692077-108692099 TATGGGGGCACCAGGCGCAGTGG + Intergenic
1059374652 9:113872757-113872779 TGTGGGGAAGCCAAGAGAAGGGG - Intergenic
1061222957 9:129262873-129262895 TGTGGGGAGGCCAGGCACAGTGG - Intergenic
1061264621 9:129497800-129497822 TCTGCGGAGGCCAGGCCCAGGGG - Intergenic
1185482717 X:459709-459731 TCTGGGGCCGGCAGGCGGAGAGG - Intergenic
1186228762 X:7429809-7429831 TCTGAGGAAGCCAGGGAAAGAGG + Intergenic
1186768195 X:12791912-12791934 GCTGGGGACGCCAGGCCGGGCGG - Intronic
1188107921 X:26165201-26165223 TCTGGGGACTCCAGGTGGTGAGG + Intergenic
1188111315 X:26198458-26198480 TCTGGGGACTCCAGGTGGTGAGG + Intergenic
1188564122 X:31505917-31505939 TCTGGGTGGGCCAGGCGTAGTGG - Intronic
1188627824 X:32308726-32308748 TCTGAGTATGCCAGGCTAAGAGG + Intronic
1191869862 X:65736721-65736743 CCTGGGGAGGCCAGGCGCGGTGG - Intronic
1193641687 X:84016505-84016527 TCTTGGGACCCCAAGAGAAGAGG - Intergenic
1195714966 X:107809707-107809729 TCAGGGGATGCCAGGCGCTGTGG - Intergenic
1198795140 X:140386596-140386618 TTTGGGGACTCAAGGAGAAGGGG - Intergenic
1199808917 X:151329660-151329682 ACTGGGGACACCAGGAAAAGTGG - Intergenic
1200233613 X:154458193-154458215 TCCGGGGACGCCCGGCCGAGGGG - Intergenic
1201596971 Y:15680973-15680995 TCTGAGGAAGCCAGGGAAAGGGG + Intergenic