ID: 1160691817

View in Genome Browser
Species Human (GRCh38)
Location 19:463815-463837
Sequence CCTGTTTCCCACACAGTGAA CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 184}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160691817_1160691830 27 Left 1160691817 19:463815-463837 CCGTTCACTGTGTGGGAAACAGG 0: 1
1: 0
2: 1
3: 14
4: 184
Right 1160691830 19:463865-463887 CCTGTGCCCCGCAGGCCGGGAGG 0: 1
1: 0
2: 2
3: 26
4: 243
1160691817_1160691826 19 Left 1160691817 19:463815-463837 CCGTTCACTGTGTGGGAAACAGG 0: 1
1: 0
2: 1
3: 14
4: 184
Right 1160691826 19:463857-463879 CCGGGCAGCCTGTGCCCCGCAGG 0: 1
1: 1
2: 1
3: 30
4: 266
1160691817_1160691822 0 Left 1160691817 19:463815-463837 CCGTTCACTGTGTGGGAAACAGG 0: 1
1: 0
2: 1
3: 14
4: 184
Right 1160691822 19:463838-463860 CCTGGCCTAGCAGCAGCGGCCGG 0: 1
1: 0
2: 2
3: 36
4: 330
1160691817_1160691820 -4 Left 1160691817 19:463815-463837 CCGTTCACTGTGTGGGAAACAGG 0: 1
1: 0
2: 1
3: 14
4: 184
Right 1160691820 19:463834-463856 CAGGCCTGGCCTAGCAGCAGCGG 0: 1
1: 0
2: 4
3: 34
4: 383
1160691817_1160691831 28 Left 1160691817 19:463815-463837 CCGTTCACTGTGTGGGAAACAGG 0: 1
1: 0
2: 1
3: 14
4: 184
Right 1160691831 19:463866-463888 CTGTGCCCCGCAGGCCGGGAGGG 0: 1
1: 0
2: 1
3: 16
4: 224
1160691817_1160691828 24 Left 1160691817 19:463815-463837 CCGTTCACTGTGTGGGAAACAGG 0: 1
1: 0
2: 1
3: 14
4: 184
Right 1160691828 19:463862-463884 CAGCCTGTGCCCCGCAGGCCGGG 0: 1
1: 0
2: 2
3: 63
4: 408
1160691817_1160691823 1 Left 1160691817 19:463815-463837 CCGTTCACTGTGTGGGAAACAGG 0: 1
1: 0
2: 1
3: 14
4: 184
Right 1160691823 19:463839-463861 CTGGCCTAGCAGCAGCGGCCGGG 0: 1
1: 0
2: 1
3: 22
4: 198
1160691817_1160691827 23 Left 1160691817 19:463815-463837 CCGTTCACTGTGTGGGAAACAGG 0: 1
1: 0
2: 1
3: 14
4: 184
Right 1160691827 19:463861-463883 GCAGCCTGTGCCCCGCAGGCCGG 0: 1
1: 1
2: 5
3: 39
4: 366

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160691817 Original CRISPR CCTGTTTCCCACACAGTGAA CGG (reversed) Exonic
901009089 1:6188698-6188720 GCTGTTTCTCCCACAGTGAAAGG + Intronic
903196400 1:21692003-21692025 CCTGTTACACACACAGTTCAAGG - Intronic
903335625 1:22622301-22622323 CATGTTACCCACTCAGTGGAGGG + Intergenic
904428292 1:30445840-30445862 CCTGTTTCCCCCCCATTCAAAGG - Intergenic
904676561 1:32202260-32202282 CCTTTTTGCCACACAGTTGAGGG - Intronic
905783969 1:40737760-40737782 CATGTTACCTACACAGTTAATGG + Intronic
913062224 1:115219077-115219099 CCTGGTTCCCATACTGTGGATGG - Intergenic
913324802 1:117617576-117617598 TCTGTTTCTCAAACAGTAAAAGG + Intronic
914676893 1:149912851-149912873 CTTGTTCCCCAATCAGTGAAAGG + Intronic
915986304 1:160468885-160468907 CTAGCTTCCCACACAGTGAATGG - Intergenic
917078744 1:171235001-171235023 CCTGTTTCCCCCTCAAAGAATGG + Intergenic
919648857 1:200125310-200125332 CCTGTTTCCAGCAAAATGAATGG + Intronic
920536040 1:206737199-206737221 CCTGTCTCCAACCCAGTCAAAGG - Intergenic
921578968 1:216873661-216873683 CATTTTTTCCACACAGTGCAAGG + Intronic
921868871 1:220115758-220115780 TCAGTCTCACACACAGTGAATGG - Intronic
922961256 1:229647540-229647562 CCTGTGTCCCTCACAGTGGTCGG + Exonic
923642329 1:235777469-235777491 GCTGTTTCCCACAAAGCAAATGG + Intronic
924919904 1:248617941-248617963 AGTGTTTACCACTCAGTGAAGGG + Intergenic
1064294528 10:14066329-14066351 CCTGTTGTCCACACAGGGAAGGG + Intronic
1065629168 10:27659931-27659953 CCTGTTTCCCGCACAGGCAGTGG + Intergenic
1065757772 10:28949828-28949850 CCTGATTCTGACACAGTGACCGG + Intergenic
1065968582 10:30787984-30788006 GCTGTTTCCCAGACAGTGCAAGG - Intergenic
1066654823 10:37687633-37687655 CCTGTTTCCTGCACTGGGAATGG - Intergenic
1068401419 10:56532427-56532449 CATCTTTACCACACAGTCAAAGG - Intergenic
1069716184 10:70522926-70522948 CCTGCTGGCCACACACTGAAGGG - Intronic
1072245946 10:93544017-93544039 CCAGTTTCTGATACAGTGAAGGG + Intergenic
1072895160 10:99360169-99360191 CCTGATTCCCTCCCAGTGGAGGG + Intronic
1074735004 10:116421884-116421906 GCTCTTTCCCACATTGTGAAAGG - Intergenic
1075431901 10:122391517-122391539 CTTTTTTCCCCCACATTGAATGG + Intronic
1078961653 11:16280498-16280520 GCGGTTTGCCACAAAGTGAAGGG - Intronic
1079496849 11:21053618-21053640 CCTGAGTCCCATACAGTGAAGGG + Intronic
1083465427 11:62842458-62842480 CATCTTTCCCTCTCAGTGAAGGG - Intergenic
1085726323 11:78958087-78958109 TCAGTTTCCTAAACAGTGAAAGG + Intronic
1086268446 11:85029579-85029601 ACTGTTCCCCACACATTGGAGGG - Intronic
1086989266 11:93285395-93285417 CTTGCTTCCCACACAGGGACTGG - Intergenic
1088042800 11:105408045-105408067 TCTTTTTCCCCCACAGGGAAAGG - Intergenic
1088366673 11:109047186-109047208 CCAGTATCCAACACTGTGAAGGG + Intergenic
1089112754 11:116070111-116070133 AATGTTTCCCACACAGTCTATGG - Intergenic
1089362857 11:117902484-117902506 CCTGTTCCCCAGGCAGAGAAGGG + Intronic
1089507669 11:118974874-118974896 CCTGTCTCCCACTCAGTACAAGG - Intronic
1089748806 11:120635625-120635647 CCTGTTGCCTGCAGAGTGAATGG + Intronic
1090470609 11:126977905-126977927 CCTGTGTACCACACAGTCAGAGG + Intronic
1090750515 11:129743014-129743036 ACTTTTTCTCACACAGGGAAGGG + Intergenic
1097021072 12:56021152-56021174 CCCTTTTCCAAGACAGTGAAGGG - Intronic
1097268227 12:57758092-57758114 CCTTTCTCCCACACAGTGGCAGG + Exonic
1105478224 13:20747870-20747892 GCTGTATCCCATACAATGAATGG + Intronic
1106958350 13:34969136-34969158 CTTGTTTTCAACATAGTGAAAGG + Intronic
1108700655 13:52941340-52941362 CCTGGCTCCCACCCACTGAATGG + Intergenic
1110266417 13:73542653-73542675 CCTGTTTTCCACACTGCAAAGGG - Intergenic
1110313345 13:74076472-74076494 GGTGTTCCCCACACAGTGGAAGG + Intronic
1113605328 13:111600585-111600607 GGTGTTTCCCACACAGGGAAGGG - Intronic
1115480721 14:33858520-33858542 CCTGTTTCCCTCTCTATGAATGG + Intergenic
1117875242 14:60245420-60245442 CCAGTGTCCCACACAGTGCTTGG + Intergenic
1120440454 14:84530671-84530693 CCTCTTTCCCAAACTCTGAAAGG - Intergenic
1122153451 14:99736961-99736983 CCTGGTCCCCACAAAGTGCAGGG - Intergenic
1122987238 14:105218094-105218116 CCTGGGTCCCACACAGGGCAGGG + Intronic
1123428507 15:20193451-20193473 CCTGTTTCCCCCCCGGTCAAAGG + Intergenic
1124912419 15:33934861-33934883 CCTGTTTCCTCAACTGTGAAGGG + Intronic
1125184537 15:36915433-36915455 AGTGTTTCCCAAACACTGAAAGG - Intronic
1125672011 15:41480567-41480589 CTTCTTTCCCACAGAGTCAAAGG + Exonic
1127666448 15:61152353-61152375 ACTCTTTTCCTCACAGTGAATGG - Intronic
1129291191 15:74569227-74569249 CCTGTAACCCACCCAATGAAAGG + Intronic
1130170800 15:81511237-81511259 CCTGTTTCCCAGACTCTAAAAGG + Intergenic
1132229939 15:100174100-100174122 CCTTTTTCCCACAAAGTCCAGGG + Intronic
1132791049 16:1688190-1688212 CCTGTTTCCTCCTCTGTGAAAGG - Intronic
1133026332 16:2990443-2990465 TCTCTTTCCCAGACACTGAAGGG + Intergenic
1133175382 16:4010538-4010560 CCTGTTTACTACACACTGATGGG + Intronic
1133479491 16:6156270-6156292 CCTGCTTCCCCCACAGCTAATGG + Intronic
1136995017 16:35183191-35183213 CCTGTCACGCACACACTGAAGGG + Intergenic
1139630634 16:68230037-68230059 CCTGTTTCCCCCAAAGACAATGG - Exonic
1143360490 17:6365243-6365265 CCTGCCTCCCCCACAGTGCAGGG + Intergenic
1144103180 17:11962044-11962066 CCTGTCAGCCACACAGTGGAGGG - Exonic
1144994591 17:19258758-19258780 CAGGGTTCCCACACAGGGAAAGG + Intronic
1145838066 17:27969858-27969880 CCTGTCTCCTATTCAGTGAATGG + Intergenic
1146500709 17:33362122-33362144 CTTGCTTCCCACACAGAGCATGG - Intronic
1148349964 17:46934106-46934128 CCTGTTACCCACACTGTAGAGGG - Intronic
1149645568 17:58238928-58238950 CCTTTTTCCCCCACAGTGGTGGG - Intronic
1151765445 17:76131198-76131220 CCTGTTCCCCACCCCCTGAAGGG - Intergenic
1152126452 17:78450164-78450186 CCTGTTGCCCACACAGCCATCGG - Intronic
1152333232 17:79685407-79685429 CCTGTGTCCGTCACAGTGAGTGG - Intergenic
1156290836 18:35747734-35747756 CCTGTTTACCACAGAGGGAAGGG - Intergenic
1156632190 18:38983696-38983718 CCTGTTTCCAATAGAGTCAAGGG - Intergenic
1157147250 18:45176406-45176428 CCTGTTTCTCAACCAGAGAAAGG - Intergenic
1160691817 19:463815-463837 CCTGTTTCCCACACAGTGAACGG - Exonic
1160990354 19:1857823-1857845 CCTCTTACCCACCCAGGGAAGGG + Intronic
1162961106 19:14127413-14127435 CCTCTTTCACACACAGGGACCGG + Intronic
1163571221 19:18083527-18083549 CCTTCTCCCCACACAGTGCAAGG - Intronic
1163600862 19:18248289-18248311 CCTGGTGCCCAGACAGTTAAGGG - Intronic
1165317111 19:35063159-35063181 CCTGTTTTCCACCCAGGAAAAGG + Intronic
1167537261 19:50062124-50062146 CATGTGACCCACACAGGGAAAGG + Intergenic
925142107 2:1557735-1557757 TCTGTGTCCCACACAGTCAGGGG - Intergenic
925761028 2:7184580-7184602 CATGATTCCTACAAAGTGAATGG - Intergenic
925947142 2:8875960-8875982 TTTGTTGCCCACACAGTGGAGGG + Intronic
928464286 2:31506233-31506255 CTCATTTCCCATACAGTGAAGGG - Intergenic
930561755 2:52968094-52968116 TCTGTTTCTAGCACAGTGAATGG + Intergenic
933670465 2:85002636-85002658 CCTGGATCCCACACAGAAAAGGG - Intronic
936697156 2:114964765-114964787 CCTGTTTCTCCCACACTGAGAGG - Intronic
940879352 2:158930949-158930971 TATGTTTTCCACACAGGGAAAGG - Intergenic
941784831 2:169485832-169485854 CCTGGTTCCTTCCCAGTGAAGGG + Intronic
945249488 2:207752215-207752237 CCTGCATCCTATACAGTGAAGGG - Intronic
945273531 2:207965187-207965209 CCAGTTTCTCTCCCAGTGAAAGG + Intronic
945636401 2:212357732-212357754 CAAGTCTCCCACACAGTGGAGGG - Intronic
945965895 2:216186185-216186207 GATGTTTCCAACAAAGTGAAAGG - Intronic
948932192 2:241139213-241139235 CCTGTTTCCCACCTAGTGTGTGG - Intronic
1169756083 20:9044898-9044920 AATGTTTCCCACCCAGGGAATGG - Intergenic
1171438169 20:25140001-25140023 TCTGTTTCCCACACTGTGCTGGG - Intergenic
1171879849 20:30610666-30610688 GCTGTTCCAAACACAGTGAAAGG + Intergenic
1172010604 20:31843888-31843910 CCTGTTTCCACCACTGTAAACGG + Intergenic
1174471323 20:50763225-50763247 CCTGGTATCCACACAGTGAGTGG - Intergenic
1174869707 20:54171664-54171686 CCTGCTTCTCTCACAGGGAAGGG - Exonic
1177254558 21:18644225-18644247 CCTTTTTCCCATACTGGGAATGG + Intergenic
1177343418 21:19835775-19835797 CCTGTTTTCAACACAGTGACTGG + Intergenic
1180686913 22:17675951-17675973 CCTGCTTTCCACACTGTGAAAGG - Intronic
1181910881 22:26237292-26237314 CCTGTTTCCCACAATGAGCAGGG + Intronic
949933538 3:9099213-9099235 CCTTGTTGCCACACAGTGAATGG + Intronic
950433377 3:12964619-12964641 CCTGTTTCCCCTTCTGTGAAAGG - Intronic
951106760 3:18753122-18753144 CCTATTTCCAACACAGTGTTTGG + Intergenic
952872081 3:37909888-37909910 TTTATTTCCCACAAAGTGAATGG + Intronic
953664308 3:44915131-44915153 CTTGTCTCCCACACTGGGAATGG + Intergenic
955596118 3:60592581-60592603 CCTGCTGCCCAGGCAGTGAATGG - Intronic
955784758 3:62525628-62525650 CCTTTTTCCCACAAAGATAAAGG - Intronic
956046109 3:65197739-65197761 CCAGTTTCCCACAGAGTGGATGG + Intergenic
960789459 3:121412231-121412253 CCTGTTTCTAACACTGAGAATGG + Intronic
961053750 3:123768800-123768822 CCTGTTCACCAGACAGTGTATGG - Intronic
961793345 3:129392339-129392361 GCTGTTTCTCACACATTGTAGGG + Intergenic
961807347 3:129498957-129498979 GCTGTTTCTCACACATTGTAGGG + Intronic
961921346 3:130429659-130429681 CCTGTTTCCCACGGAGTTGAGGG - Intronic
962640882 3:137385240-137385262 CAAGATTCACACACAGTGAAAGG - Intergenic
964876134 3:161371249-161371271 TTAGTTTCCCACATAGTGAAAGG + Intronic
966903001 3:184500509-184500531 CCTGCCTCCCACACACAGAAAGG + Intronic
967129219 3:186455228-186455250 CCTGGTTCCCAGACACTGATTGG + Intergenic
967938364 3:194747308-194747330 CCTGTGTCCCAGCCAGTGATGGG + Intergenic
969192815 4:5535923-5535945 CCTGTCTCCTACACAGTGCCTGG + Intergenic
969310735 4:6351808-6351830 CCCGGTGCCCACACCGTGAAGGG - Intronic
969928970 4:10611812-10611834 CCTGGCTGCAACACAGTGAATGG - Intronic
970882530 4:20948558-20948580 CCTGTTTCCCACAGAATGTGAGG - Intronic
971167911 4:24203129-24203151 CCTGTGGTCCACACAGGGAAAGG + Intergenic
976591427 4:86852990-86853012 ACTGTTTCCCACGCTCTGAAAGG + Intergenic
978055761 4:104263696-104263718 TCTATTTTCCTCACAGTGAACGG + Intergenic
978206066 4:106082846-106082868 CCTGTGATCCACACAGGGAAGGG + Intronic
980270201 4:130574448-130574470 CCTGTTTCCATGACAATGAAAGG - Intergenic
980548472 4:134301931-134301953 CCTGTATCCCTCAAAGTGGAGGG + Intergenic
987987164 5:25162356-25162378 CCTGTATCCATCACAATGAAAGG - Intergenic
988446592 5:31292946-31292968 CCTTTTTCCCACCCAGCAAAAGG - Intronic
991036652 5:62134400-62134422 CCTATTTCTCACATGGTGAAAGG + Intergenic
991501935 5:67285838-67285860 CCTGGTTCAGACACACTGAAGGG + Intergenic
992524479 5:77594719-77594741 CCTGTAGCTCAGACAGTGAAGGG - Intronic
993396294 5:87393437-87393459 CCAGTTTCCCACACTGAAAATGG - Intronic
993458553 5:88154820-88154842 CCTGTTACCCAAACATTTAAAGG - Intergenic
994078333 5:95678691-95678713 CATACTTCCCAAACAGTGAAAGG - Intronic
994367333 5:98929915-98929937 TATGTTTCCAACACACTGAAGGG - Intergenic
998674301 5:144389872-144389894 TCTTTTTCCCAAACAGGGAAAGG - Intronic
999894522 5:156015558-156015580 CCTGTTTACCAGACAGAAAAAGG + Intronic
1000108542 5:158084555-158084577 CCTGTTTCCCACACCCTTTAGGG - Intergenic
1000724749 5:164755411-164755433 CCTGGTACCCACAGAATGAATGG + Intergenic
1001741256 5:174054707-174054729 CCCATTTCACAGACAGTGAATGG + Intronic
1006254035 6:32815043-32815065 CCTTTTCTCCCCACAGTGAAGGG + Exonic
1007103780 6:39269314-39269336 CCTGTTTCCTACACAGTGCAGGG - Intergenic
1011541877 6:88439539-88439561 CCTGTATCCCCCACAGATAAGGG + Intergenic
1012378070 6:98586370-98586392 CCTTTTGCCCACACAGGGAGAGG - Intergenic
1016290529 6:142524015-142524037 CCTTTTTCCCCAATAGTGAAAGG + Intergenic
1019906369 7:4068134-4068156 GCTGCTGCCCACACAGTAAAGGG - Intronic
1020265284 7:6556425-6556447 CCTCTTTCCCACCTAGTGCAAGG - Intergenic
1021231369 7:18088962-18088984 GCTTTTTCCCACACAGAAAATGG - Intronic
1021865077 7:24947904-24947926 CATCTTTGGCACACAGTGAATGG - Intronic
1023487614 7:40703550-40703572 CTCTTTTCCCACACTGTGAAAGG - Intronic
1023609579 7:41959273-41959295 CCTATGTCCCAGACAGTGCAAGG + Intergenic
1024466353 7:49715378-49715400 CATGGTTCCCACATATTGAAAGG - Intergenic
1024669962 7:51585320-51585342 CCTGTTTCCCATTCAGTTATTGG + Intergenic
1024929976 7:54659344-54659366 CCAGTGCCTCACACAGTGAAAGG + Intergenic
1028712028 7:93920692-93920714 CCTGCTTCCTAAACAGGGAATGG + Intergenic
1028730836 7:94146788-94146810 CCTGATCCAGACACAGTGAAGGG - Intergenic
1029338502 7:99923200-99923222 TTTGTTACCCACACAATGAATGG + Intergenic
1035185713 7:157124491-157124513 CCTACTTCCCACACATTGAAGGG + Intergenic
1037433565 8:18839842-18839864 CCTGCCTCCCACACAGTCGATGG + Intronic
1038322259 8:26538461-26538483 CCTTTTTCCCCCACAGGGAGAGG - Intronic
1040602786 8:48900462-48900484 CTTCCTTCACACACAGTGAAGGG - Intergenic
1040795082 8:51281583-51281605 CCTGTGTCCCACACAGGCCATGG - Intergenic
1041197152 8:55411627-55411649 CCTCATTCCCACAGAGTCAATGG - Intronic
1041583227 8:59486500-59486522 CTTGTTTCCCCCACAGAGAGAGG - Intergenic
1043790088 8:84454808-84454830 CCTGTTCCCAACACAGTGCAAGG + Intronic
1044171478 8:89057687-89057709 CCTGTTTCCTACACAGGGTCAGG + Intergenic
1044356230 8:91225419-91225441 CCTGATAGCCACACAGGGAAGGG - Intronic
1046598772 8:116293421-116293443 TCTGTTTACCAAACACTGAATGG - Intergenic
1048117002 8:131534444-131534466 CCTGTTTCCCATACTGGGAATGG - Intergenic
1048333039 8:133484127-133484149 TCTGTTCACCACCCAGTGAATGG - Intronic
1050762519 9:9089870-9089892 CATTTTTCAAACACAGTGAAAGG - Intronic
1053389760 9:37726164-37726186 GCTGTTTACGACACAGAGAAAGG + Intronic
1056542904 9:87589407-87589429 CATCTTTCCCACTAAGTGAAGGG + Intronic
1059709838 9:116857489-116857511 CCTGTATCCAGCACTGTGAATGG - Intronic
1059721233 9:116962013-116962035 ACTGTTACCCGCATAGTGAATGG + Intronic
1060260129 9:122067176-122067198 CCTGTTTTCCAAACAAAGAAGGG - Intronic
1187407371 X:19015988-19016010 CCTGTGTGCCTCACAGTGGATGG - Intronic
1187714794 X:22092089-22092111 ACTGGTTCCAACGCAGTGAAGGG - Intronic
1190832540 X:54072249-54072271 CCTATTGCCCACACCATGAAAGG - Exonic
1193990698 X:88303205-88303227 CCTGTATCCCAAAGTGTGAATGG - Intergenic
1197026528 X:121756522-121756544 CCTGTTGACCACAGAGAGAAGGG + Intergenic
1199195879 X:145029916-145029938 TCTGTGTCCAGCACAGTGAATGG - Intergenic
1200283020 X:154794625-154794647 CTCCTTCCCCACACAGTGAATGG - Intronic
1201584555 Y:15546400-15546422 CATGTTTCCCAGCCAGAGAAAGG - Intergenic