ID: 1160691827

View in Genome Browser
Species Human (GRCh38)
Location 19:463861-463883
Sequence GCAGCCTGTGCCCCGCAGGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 412
Summary {0: 1, 1: 1, 2: 5, 3: 39, 4: 366}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160691815_1160691827 25 Left 1160691815 19:463813-463835 CCCCGTTCACTGTGTGGGAAACA 0: 1
1: 0
2: 0
3: 10
4: 104
Right 1160691827 19:463861-463883 GCAGCCTGTGCCCCGCAGGCCGG 0: 1
1: 1
2: 5
3: 39
4: 366
1160691816_1160691827 24 Left 1160691816 19:463814-463836 CCCGTTCACTGTGTGGGAAACAG 0: 1
1: 0
2: 0
3: 16
4: 168
Right 1160691827 19:463861-463883 GCAGCCTGTGCCCCGCAGGCCGG 0: 1
1: 1
2: 5
3: 39
4: 366
1160691817_1160691827 23 Left 1160691817 19:463815-463837 CCGTTCACTGTGTGGGAAACAGG 0: 1
1: 0
2: 1
3: 14
4: 184
Right 1160691827 19:463861-463883 GCAGCCTGTGCCCCGCAGGCCGG 0: 1
1: 1
2: 5
3: 39
4: 366
1160691814_1160691827 26 Left 1160691814 19:463812-463834 CCCCCGTTCACTGTGTGGGAAAC 0: 1
1: 0
2: 1
3: 11
4: 92
Right 1160691827 19:463861-463883 GCAGCCTGTGCCCCGCAGGCCGG 0: 1
1: 1
2: 5
3: 39
4: 366
1160691821_1160691827 0 Left 1160691821 19:463838-463860 CCTGGCCTAGCAGCAGCGGCCGG 0: 1
1: 0
2: 2
3: 26
4: 254
Right 1160691827 19:463861-463883 GCAGCCTGTGCCCCGCAGGCCGG 0: 1
1: 1
2: 5
3: 39
4: 366
1160691824_1160691827 -5 Left 1160691824 19:463843-463865 CCTAGCAGCAGCGGCCGGGCAGC 0: 1
1: 0
2: 5
3: 93
4: 3294
Right 1160691827 19:463861-463883 GCAGCCTGTGCCCCGCAGGCCGG 0: 1
1: 1
2: 5
3: 39
4: 366
1160691813_1160691827 27 Left 1160691813 19:463811-463833 CCCCCCGTTCACTGTGTGGGAAA 0: 1
1: 0
2: 0
3: 7
4: 75
Right 1160691827 19:463861-463883 GCAGCCTGTGCCCCGCAGGCCGG 0: 1
1: 1
2: 5
3: 39
4: 366

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160691827 Original CRISPR GCAGCCTGTGCCCCGCAGGC CGG Exonic
900204526 1:1426387-1426409 TGAGCCTGTGCCCCGTGGGCGGG + Intronic
900314901 1:2051638-2051660 GCAACCTGAGCCCCAGAGGCAGG + Intronic
900397899 1:2460731-2460753 ACAGCCTTGGCCCCACAGGCAGG - Intronic
900599878 1:3498393-3498415 GCTGCCTCTGCCCAGCCGGCTGG - Exonic
900619570 1:3580635-3580657 ACAGCAGGTGCCCCCCAGGCTGG + Intronic
900622651 1:3594500-3594522 GCAGCCTGTCCCTCACTGGCAGG + Intronic
900651875 1:3733783-3733805 TCAGCCAGTGCCCCTCAGCCTGG + Exonic
900745367 1:4356989-4357011 GCAGCGTTTGCCCTGCAGGTCGG - Intergenic
900800096 1:4732013-4732035 GGAGCCTGTGCCCCACATGCAGG + Intronic
900887758 1:5427502-5427524 GATGCCTGGGCCCAGCAGGCTGG - Intergenic
901040150 1:6358707-6358729 GGCCCCTGTGCCCAGCAGGCTGG - Intronic
901973512 1:12926652-12926674 TCAGCCTGTGTTCCTCAGGCTGG + Intronic
902011667 1:13275115-13275137 TCAGCCTGTGTTCCTCAGGCTGG - Intergenic
903034812 1:20486537-20486559 GCAGCATCTGCCCCCCAGGGGGG - Intergenic
903212165 1:21824408-21824430 GCAGCCTCTGCTCTCCAGGCTGG - Exonic
903606539 1:24579026-24579048 GCAGACTGTGCCCGGCAGCGCGG + Intronic
903813419 1:26047026-26047048 GGAGCCTGTGGCCCCCACGCTGG + Intergenic
903884446 1:26532671-26532693 ACAGCACGTGCCCCACAGGCAGG - Intronic
905463896 1:38138758-38138780 GCTGCCTCTGCCACTCAGGCCGG - Intergenic
905789081 1:40780890-40780912 GCACCCAGTGCCCAGCCGGCAGG + Intergenic
905883187 1:41477616-41477638 GCAGCCTGGGCACCACAGGGAGG - Intergenic
905917574 1:41696305-41696327 GCAGGCTGCGCCCCGTGGGCAGG - Intronic
907272587 1:53299539-53299561 GCAGGCTGTGCCCAGGAGGCTGG + Intronic
907451883 1:54550741-54550763 GCAGCCTCCGCCTCCCAGGCAGG - Intronic
907961171 1:59283298-59283320 GCAGCCTGGGCCCCAGAGGATGG - Intergenic
912508394 1:110172183-110172205 GAAGCCGATGCCCCCCAGGCGGG - Exonic
912559206 1:110538161-110538183 GCTGCCAGGGCCCTGCAGGCTGG - Intergenic
915592918 1:156880690-156880712 GCAGTCTGCTCCCCGGAGGCTGG + Intronic
918741071 1:188131031-188131053 GCAGCCTGTGGGCCACAGGTTGG + Intergenic
919945946 1:202319018-202319040 GCAGCCAGGGGCCCCCAGGCTGG + Exonic
922441259 1:225656755-225656777 GCAACCTCTGCCTCCCAGGCTGG - Intergenic
923658354 1:235937753-235937775 TCAACCTGCGCCCAGCAGGCTGG - Intergenic
1063029725 10:2222227-2222249 CCATCCTGTGCACTGCAGGCTGG - Intergenic
1065170935 10:23028098-23028120 GCAGCCAGTGCACCCCAGCCTGG + Intronic
1065259842 10:23913215-23913237 ACTGCCTGTGCCCTGCAGTCTGG - Intronic
1066416114 10:35223466-35223488 GCAGCCTGTGTCCTGGAGGATGG - Intergenic
1067063238 10:43088959-43088981 GGAGCCAGTGCCCGGCAGGACGG - Intronic
1067227501 10:44385358-44385380 GCAGCCTGAGCGACGCCGGCTGG + Intronic
1067774055 10:49149029-49149051 GCAGCATGTGGCCTTCAGGCTGG - Intergenic
1067972794 10:50991679-50991701 CCAGCCTCTGCGCCGCGGGCCGG - Intronic
1068688450 10:59892480-59892502 GCTCCCTGTGCACCGCAGGTTGG - Intronic
1070750595 10:78961894-78961916 GCATCCTGTGGCCAGCAGGTAGG - Intergenic
1071508334 10:86246191-86246213 GCATCCTTTGCCCTCCAGGCTGG - Intronic
1072336523 10:94402936-94402958 GGAGCCCGAGCCCAGCAGGCAGG - Exonic
1072740324 10:97905239-97905261 GAACCCTGTGCTCCCCAGGCAGG - Intronic
1073460670 10:103664026-103664048 GCTGCCTCTGCCCAGCTGGCAGG - Intronic
1074857467 10:117483865-117483887 CCACCCTGTGCCCCACAGTCAGG - Intergenic
1075106584 10:119543301-119543323 GCAGCCAGGCCCCAGCAGGCGGG - Intergenic
1075475601 10:122730929-122730951 GCCACCTTTGCCCTGCAGGCTGG - Intergenic
1075629923 10:123994728-123994750 GCAGCCTGTCTCCGGAAGGCCGG + Intergenic
1075679718 10:124323459-124323481 GCAGCCTCTGCCCTGCAGAAAGG + Intergenic
1075715437 10:124552599-124552621 CCAGCCACTGCCCCCCAGGCTGG + Intronic
1075873543 10:125788616-125788638 GCTTCCTGTGCCCAGCAGGAAGG - Exonic
1076287759 10:129317049-129317071 GCAGCCTGTGGGCTGCAGGTTGG - Intergenic
1076356880 10:129859723-129859745 CCAGCGTGTGCCCCGCCAGCTGG - Intronic
1076366883 10:129926904-129926926 GCAGCCTGTCCCCCGGGAGCAGG - Intronic
1076421955 10:130338206-130338228 GCAGCCAGTCCCCGGCAGCCTGG - Intergenic
1076639081 10:131901513-131901535 TCCGCCCGTGCCCCGCGGGCCGG - Intronic
1076730852 10:132438246-132438268 GCTGCCTGTGCCGGGCAGGGAGG - Intergenic
1076769118 10:132653436-132653458 ACGGCCTGTGCCCGGCAGCCAGG - Intronic
1076810376 10:132883497-132883519 GCAGCCCACGCCCTGCAGGCGGG + Intronic
1077184248 11:1229278-1229300 GCTGCTTCTGCCCCCCAGGCAGG + Exonic
1077344378 11:2039562-2039584 GCAGCCTCTGCCCCACAGCCCGG - Intergenic
1077394804 11:2315605-2315627 CCCTCCTGTCCCCCGCAGGCAGG - Intronic
1077483997 11:2830601-2830623 TCAGCCTGGGCCAGGCAGGCTGG + Intronic
1079411810 11:20194752-20194774 GCAGCCTGTGTGCCTCAGGTTGG - Intergenic
1079968930 11:27012408-27012430 GCAGGCTGTGACCCTCAGTCTGG + Intergenic
1082679244 11:56148343-56148365 CCAGCCTGTGTCGCCCAGGCTGG + Intergenic
1083529817 11:63409532-63409554 GCAGCCTGTGGGCCATAGGCTGG + Intronic
1083994915 11:66267107-66267129 TCAGCCTGAGCCCTGGAGGCTGG + Exonic
1084149010 11:67279450-67279472 GGAGCGTGTGGCCCGCAGCCGGG + Exonic
1085309452 11:75507480-75507502 GCAGCCAGTGCCCCCCAGCCTGG - Intronic
1088745664 11:112801963-112801985 GAGGCCTGAGCCCCACAGGCAGG + Intergenic
1089261919 11:117229526-117229548 CCGGCCTGTGCCCAGCAGGCTGG + Exonic
1089645560 11:119876395-119876417 GGAGCCTGTGTCCTGCTGGCTGG + Intergenic
1090186216 11:124740561-124740583 GCGCCCTGTGCAGCGCAGGCTGG + Intronic
1090869507 11:130730785-130730807 GCAGCCTGTGGGCCACAGGTTGG - Intergenic
1202827364 11_KI270721v1_random:94751-94773 GCAGCCTCTGCCCCACAGCCCGG - Intergenic
1091752827 12:3033287-3033309 GCAGCCTCAGCCCTTCAGGCTGG - Intronic
1092630657 12:10372661-10372683 GCAGCATGACCCCCACAGGCAGG + Exonic
1094819119 12:34211219-34211241 GCAGCCTCTGCCCCGGACCCAGG - Intergenic
1095859188 12:46896555-46896577 GCAGCCTGTGGGCCGCGGGTTGG - Intergenic
1096590420 12:52655293-52655315 GCAGCCTGAGCCCAGCAGCAGGG - Intergenic
1096650511 12:53059950-53059972 ACACCATGTGCCCCGAAGGCAGG + Exonic
1096883875 12:54698002-54698024 GCAGCCTGTGCTCCTCAGGCTGG + Intergenic
1098595774 12:72272338-72272360 GCAGCATGTGCCCCGCCGCCGGG + Intronic
1100080771 12:90847301-90847323 GCAGACTGGGCCCCGCATGGTGG - Intergenic
1101660241 12:106759113-106759135 CCAGCCTGTGCCTCTCGGGCCGG - Intronic
1102958374 12:117074587-117074609 GCAGCCTGAGCCCCTAAGTCGGG + Intronic
1104595095 12:130115440-130115462 CTAGCCTGTCCCCGGCAGGCAGG + Intergenic
1105578917 13:21675595-21675617 GCAGCCTCTCCTCCGCAGCCCGG + Intronic
1105593915 13:21818181-21818203 CCAGCCCCTGCCCCGCAGGGAGG - Intergenic
1105790144 13:23790623-23790645 GCAGCCTGTGGCCCGGAGCCAGG + Intronic
1106370665 13:29129735-29129757 ACTGCCTGTGCCCAGCATGCTGG + Intronic
1107450486 13:40504402-40504424 GCAGCCTCAGCCAGGCAGGCGGG + Intergenic
1110706861 13:78607520-78607542 GCAGCCAGCGCCCTGCATGCAGG + Intergenic
1111600017 13:90460954-90460976 GCAGCCTGTGCCACACTGTCAGG - Intergenic
1114068068 14:19083222-19083244 GCAGCCTGTGCTCTGCAGACAGG - Intergenic
1114094194 14:19316804-19316826 GCAGCCTGTGCTCTGCAGACAGG + Intergenic
1114590881 14:23863760-23863782 TCAACCTGTGCCCAGGAGGCTGG + Intergenic
1117353481 14:54902558-54902580 GCGGCCCGGGCCCAGCAGGCCGG - Exonic
1119574716 14:75709054-75709076 GCAGCCTGTGGGCCTCAGGTTGG + Intronic
1119814702 14:77555405-77555427 GCGCCCTGGGCCCCACAGGCCGG - Exonic
1120730113 14:87992636-87992658 ACAGCCTGTGCCCCACTGCCTGG + Intronic
1121265606 14:92600414-92600436 GCACCCTGACCCCAGCAGGCTGG + Intronic
1121908444 14:97768296-97768318 GCAGCCTGTGCCCCACAGTTTGG - Intergenic
1122501190 14:102200920-102200942 GCAGGATGTGCCACGCAGCCTGG - Intronic
1122919752 14:104875139-104875161 AGAGCCTGGGCCCCTCAGGCTGG - Intronic
1122920287 14:104877131-104877153 GCAGCCTGAGACCCCCTGGCCGG - Intronic
1123005918 14:105323796-105323818 GCAGCCAGTGGCCTGTAGGCTGG + Intronic
1123464844 15:20507307-20507329 GCAGCCTCTGTCCCCCAGGCTGG - Intergenic
1123627018 15:22234246-22234268 ACAGCCTGGGCCCTACAGGCCGG - Intergenic
1123653273 15:22493722-22493744 GCAGCCTCTGTCCCCCAGGCTGG + Intergenic
1123743693 15:23302585-23302607 GCAGCCTCTGACCCCCAGGCTGG + Intergenic
1124275568 15:28323286-28323308 GCAGCCTCTGTCCCCCAGGCTGG - Intergenic
1124307133 15:28588315-28588337 GCAGCCTCTGTCCCCCAGGCTGG + Intergenic
1124648539 15:31457832-31457854 GCTGCCTGTGCCCCTGCGGCAGG - Intergenic
1125768212 15:42149064-42149086 CCAGCCTGTGGCCAGGAGGCAGG - Intronic
1125770094 15:42159481-42159503 CCAGCCTGTGCACCTCTGGCAGG + Exonic
1127053652 15:55110666-55110688 TCAGCCTCTGCCCCACAGGAAGG - Intergenic
1127370556 15:58334882-58334904 GCAGCCTATGTCCAGCAGGAAGG - Intronic
1128092599 15:64929074-64929096 GCAGCCTATAGCCTGCAGGCTGG - Intronic
1129985847 15:79919322-79919344 GGAGCCTGTGCCACGCAGCCAGG - Intronic
1130541064 15:84821169-84821191 CCTGCCTGTGCCCTGCTGGCTGG - Intronic
1131425669 15:92343761-92343783 GCAGGCTGTGCCCCGCAATAGGG - Intergenic
1131483516 15:92801739-92801761 GGGGCCTGTGCCCCGAAAGCTGG - Intronic
1132502230 16:289663-289685 GCAGCCTGAGGCCAGCAGGAGGG - Intronic
1132672516 16:1107636-1107658 TCAGGCCGTGCCCCCCAGGCCGG - Intergenic
1132765187 16:1530935-1530957 GCAGCCTCGGCCTGGCAGGCAGG - Intronic
1132906116 16:2283603-2283625 AGAGCCTGTGCCTCTCAGGCGGG - Intronic
1133212457 16:4271283-4271305 CCAGCCTGTGCCACACCGGCGGG + Intronic
1134674474 16:16079841-16079863 TCAGGCTCTGTCCCGCAGGCTGG + Intronic
1135283068 16:21170030-21170052 GCAACCTCTGCCTCCCAGGCTGG + Intronic
1137558237 16:49486581-49486603 GCAGGCTGTAGCCTGCAGGCTGG - Intergenic
1139594498 16:67950009-67950031 GCGGCCTGAGCCCCCAAGGCGGG - Intronic
1139805950 16:69565818-69565840 GCAGCCCGGGCCGCGCCGGCAGG + Intronic
1140479186 16:75253355-75253377 GCAGGCAGTGCCCTGCTGGCAGG + Intronic
1141203153 16:81912884-81912906 GCAGACTGTGCCTGGCACGCAGG - Intronic
1141422438 16:83925720-83925742 GGAGCATGTGCCACGCAGGAAGG - Exonic
1141625947 16:85261112-85261134 GCAGCCTTGGCCCTCCAGGCGGG - Intergenic
1142173538 16:88634808-88634830 GCAGCCTGTGCCTGGGAGTCCGG + Intergenic
1142343919 16:89541952-89541974 GGAGCACGTGCCCCGCAGGGTGG + Intronic
1142343935 16:89542001-89542023 GGAGCACGTGCCCCGCAGGGTGG + Intronic
1142343949 16:89542048-89542070 GGAGCACGTGCCCCGCAGGGTGG + Intronic
1142717635 17:1755651-1755673 GCAGCCTGCCCCCGGCTGGCGGG - Intergenic
1142854978 17:2724335-2724357 GCAGCTCGGTCCCCGCAGGCAGG - Intergenic
1142974915 17:3637494-3637516 GCAGCCTCTGTCACCCAGGCTGG + Intronic
1143020250 17:3913878-3913900 GCAACCCGTGCCCCACGGGCCGG + Intronic
1143400357 17:6639078-6639100 GTATCCTGTGCCCCACGGGCCGG + Intronic
1144030856 17:11321772-11321794 GCAGCCTGTGGGCCACAGGTTGG - Intronic
1144572509 17:16408263-16408285 GCAGGCTGTGCCCAGCCAGCTGG + Intergenic
1144920543 17:18760367-18760389 GCAGCGTGGGGCCAGCAGGCTGG + Intronic
1145003234 17:19320244-19320266 GCTGCCTGTGACCCGCATGCTGG + Intronic
1145291599 17:21551199-21551221 GCAGCCTGTGCACGGCGGGTGGG + Exonic
1145296092 17:21593569-21593591 GCTGCTTCTGCCCCGCAGGTGGG - Intergenic
1146108370 17:30063509-30063531 GCAGCTTGAGCCCAGGAGGCTGG - Intronic
1147184615 17:38706352-38706374 GCTGCCTGTGCCAGGCAGGCGGG - Intronic
1147636782 17:41968769-41968791 GCACCCTGTGCCCAGCAAGGTGG - Intronic
1147847710 17:43416701-43416723 CCTGCCTGTGCCCCCCATGCTGG + Intergenic
1148157280 17:45431509-45431531 GCACGCTGGGCCCCGGAGGCGGG + Intronic
1148324632 17:46776176-46776198 GCAGGCACTGCCCAGCAGGCAGG - Intronic
1148505536 17:48124244-48124266 GCAGCCTTTGCTGCCCAGGCTGG + Intergenic
1150318604 17:64190737-64190759 GCAGCCTGGGCACTGCTGGCTGG + Intronic
1150388978 17:64780236-64780258 GCACACTGGGCCCCGGAGGCGGG + Intergenic
1151231256 17:72686678-72686700 TCAGCGTGTGCTCCACAGGCAGG + Intronic
1151297078 17:73193401-73193423 CCACCCTGCGACCCGCAGGCGGG + Intronic
1151678729 17:75613271-75613293 GCAGCCTGTGCCCGCCCTGCAGG + Intergenic
1151713670 17:75820563-75820585 GGAGCCTCTGCCCGGCAGGAAGG - Intronic
1151887689 17:76932805-76932827 GGGGCCTGTGCCGAGCAGGCTGG - Intronic
1152013641 17:77735731-77735753 GCAGGCTGGGCCTGGCAGGCTGG - Intergenic
1152233381 17:79125901-79125923 ACAGCCTGTGCCACCCATGCAGG + Intronic
1152542075 17:80981533-80981555 GCAGCCTGTCCCGCCCCGGCTGG - Intergenic
1152571124 17:81121717-81121739 GCAGCCTCTGCCCAGGAGCCAGG - Exonic
1152572221 17:81125839-81125861 GCAGCTGGGGCCCGGCAGGCAGG + Intronic
1152661444 17:81544165-81544187 GTAGCCTGAGCCCCCCGGGCAGG - Intronic
1152776535 17:82205493-82205515 GCAGCTGGAGCCACGCAGGCTGG - Intronic
1153636489 18:7117615-7117637 GGTCCCTGTCCCCCGCAGGCGGG - Intronic
1153688219 18:7567296-7567318 ACTGGCGGTGCCCCGCAGGCCGG - Exonic
1154209651 18:12368628-12368650 GCAACCTCTGCCTCCCAGGCTGG + Intronic
1155044088 18:22088615-22088637 GAAGCCACTGCCACGCAGGCTGG + Intronic
1158346011 18:56517895-56517917 TCAACCTCAGCCCCGCAGGCTGG + Intergenic
1158421512 18:57298956-57298978 GCAGCCTTTGCTCCTCAGCCTGG - Intergenic
1158850978 18:61495723-61495745 ACAGCCAGTGCCCCTCTGGCTGG - Intronic
1160026403 18:75221012-75221034 GCAGCCTGTGCCCAGGAGCTTGG - Intronic
1160149835 18:76390647-76390669 GCAACCCGGGTCCCGCAGGCAGG + Intronic
1160691827 19:463861-463883 GCAGCCTGTGCCCCGCAGGCCGG + Exonic
1160709027 19:542283-542305 GCCGCCCCTGTCCCGCAGGCTGG - Intergenic
1160856886 19:1221746-1221768 ACAGCCTGTGCGCGGCTGGCAGG - Intronic
1161033296 19:2069930-2069952 GCAGCCCGGGCCCCACAGGGTGG - Intergenic
1163429051 19:17255923-17255945 GCAGCCTCTGCCCCACTGCCGGG - Intronic
1163648946 19:18506005-18506027 GCAGCCTGGGCCCCCCATGCTGG + Intronic
1163664117 19:18595100-18595122 GCAGCCAGCCCCCAGCAGGCCGG + Intronic
1164649662 19:29882748-29882770 GCAGCATGTTCCCCGCTGGTGGG + Intergenic
1164693540 19:30227578-30227600 GGTGCCCGAGCCCCGCAGGCCGG - Intergenic
1164716720 19:30396678-30396700 GCAACCTCTGCCCCGCCGCCAGG + Intronic
1164746699 19:30621704-30621726 GGAGCCGGTGTCCCACAGGCTGG + Intronic
1164792638 19:31001378-31001400 GCTGCCTCTGTCCGGCAGGCAGG + Intergenic
1165079990 19:33301662-33301684 GCTGCCAGGGCCCGGCAGGCCGG + Exonic
1166358665 19:42242482-42242504 GCAGCCCGAGCCCCGCAGCCTGG - Exonic
1167483427 19:49746553-49746575 ACGGCCTGGTCCCCGCAGGCTGG - Exonic
925046097 2:773962-773984 GCACCCTGTGACCCCCAGCCTGG + Intergenic
925120818 2:1416621-1416643 GAAGCATGTGCCCAGCACGCGGG - Intronic
925197579 2:1939146-1939168 CCACCCTGTGCCACGCAGGATGG + Intronic
925552280 2:5089643-5089665 CCAACCTGGGCCCTGCAGGCTGG + Intergenic
926054452 2:9766276-9766298 GCAGCAGCAGCCCCGCAGGCGGG + Intergenic
926307170 2:11646735-11646757 GGATCCTGTGCTCCTCAGGCAGG + Intergenic
927373259 2:22382597-22382619 GCAGCCTTTGCTCCTCAGTCTGG - Intergenic
927684622 2:25161779-25161801 GCAGCCCGTGCCCCGCACCCCGG + Intronic
928284921 2:29981741-29981763 GCATCCTGTGGGCCGCAGGTTGG - Intergenic
930093922 2:47552268-47552290 GCCCCCTGTGCCCTGCAGGTGGG - Intronic
931004806 2:57836896-57836918 CCAGCCTGTGACTGGCAGGCCGG + Intergenic
931463793 2:62469857-62469879 GCAGCCTGGGTCCTGCTGGCTGG + Intergenic
932174959 2:69591598-69591620 GCAACCTCTGCCTCCCAGGCTGG + Intronic
934458493 2:94196003-94196025 GAAGCCTGTGCCCTACAGACAGG - Intergenic
935855931 2:107273972-107273994 TCAGCATGTGCACCTCAGGCAGG + Intergenic
936154954 2:110041357-110041379 GCACCCCTTGCCCAGCAGGCAGG - Intergenic
936189728 2:110330057-110330079 GCACCCCTTGCCCAGCAGGCAGG + Intergenic
937323967 2:120978066-120978088 CCATCCTGTGCACCGCAGCCTGG - Intronic
937362772 2:121240559-121240581 GCAGCCGGTGCCTCCCAGGGTGG + Intronic
937428819 2:121821254-121821276 GCCACCTCTGCCCCTCAGGCTGG + Intergenic
937901056 2:127019469-127019491 GAAGTCTGTGTCCCACAGGCTGG + Intergenic
938426898 2:131200606-131200628 GCAGCCTGTGCCCTGCACTCAGG + Intronic
944886274 2:204065561-204065583 AAAGCCTGTGCCACTCAGGCTGG - Intergenic
945080984 2:206085825-206085847 GCGGGCTGGGCCGCGCAGGCTGG - Intronic
946807085 2:223481671-223481693 GCAGCCTGTGAGACCCAGGCAGG + Intergenic
947466045 2:230347510-230347532 GCAGGCTGTGCCCCTCAGTTGGG + Intronic
947791514 2:232871822-232871844 GCAGCCCAGGCCCAGCAGGCAGG - Intronic
947982286 2:234420689-234420711 GCAGCCTCTGCACTGCAAGCAGG - Intergenic
948124597 2:235555491-235555513 GCAGCCAGTGACCCCCATGCCGG - Intronic
948348009 2:237315266-237315288 GCAGGCTCTGCCGCGCAGCCTGG - Intergenic
948405659 2:237716925-237716947 GCTGCATGTGGCCCGCAGGTTGG - Intronic
948801711 2:240436185-240436207 GCCGCCTGCGCCCCGCCGCCCGG + Intronic
948851004 2:240705691-240705713 GCAGCCTGGCCATCGCAGGCTGG + Intergenic
949045697 2:241871836-241871858 GCAGGCTGTGCCCCGCACCCGGG + Exonic
949073379 2:242040101-242040123 GCAGCCTCAGCCCTGCAGGCTGG - Intergenic
1168854899 20:1001752-1001774 AGTCCCTGTGCCCCGCAGGCTGG + Intronic
1169197367 20:3690514-3690536 GCCACATGTGCCCAGCAGGCTGG - Intronic
1169924077 20:10765179-10765201 CCAGTCTGTGGCCCGAAGGCTGG - Intergenic
1170924721 20:20712491-20712513 GAAGCCCGGGCCCCGCCGGCGGG + Intergenic
1171023350 20:21607203-21607225 GGAGCCTGTGTCCTGCTGGCAGG + Intergenic
1171337015 20:24394059-24394081 GCTGGTTGTGCCCCGCAGCCCGG + Intergenic
1172182366 20:33011212-33011234 GGAGCATCTGCCCAGCAGGCAGG - Intronic
1172526055 20:35601176-35601198 GCAGCCTGAGCCCTGGGGGCGGG + Intergenic
1173726333 20:45300918-45300940 GCTGCCTGTGCCCCGAGGGGCGG - Exonic
1174082067 20:47977607-47977629 GCAGCCTGTCCCCAGGTGGCAGG - Intergenic
1174287800 20:49484361-49484383 GCAGGCTGGGCCGGGCAGGCAGG - Intergenic
1175133586 20:56807152-56807174 GCCGCCTGTGCCCTGCAAGTGGG - Intergenic
1175958689 20:62624192-62624214 GCAGCCCCTGCCCCTCTGGCGGG - Intergenic
1176081395 20:63275055-63275077 CCCGCCTGTGCCCCGCTGCCTGG - Intronic
1176118804 20:63445004-63445026 CCATCCTGGGCCCCACAGGCAGG - Intronic
1176268447 20:64222943-64222965 ACAGCCGGTGCCTCTCAGGCTGG - Intronic
1179027454 21:37691440-37691462 GCAGGCTGTGCCAAGCAGGCTGG - Intronic
1179272924 21:39865635-39865657 TCAGCCTGTGCTCTGCTGGCTGG - Intergenic
1179427851 21:41295917-41295939 ACAGGCTGTGCCCTGCAGGCTGG + Intergenic
1179451775 21:41473104-41473126 GCACCCTGTGCCCTGCGTGCAGG + Intronic
1179792243 21:43762459-43762481 GGGGCCTGGGCCCGGCAGGCAGG - Intergenic
1179999823 21:44990439-44990461 CCGGCCTGCGCCCCGCAAGCAGG + Intergenic
1180012390 21:45059377-45059399 AGAGCCTGTGCCCAGCGGGCAGG - Intergenic
1180178054 21:46099645-46099667 CCAGCCAGTGCCCCGCGGGCTGG - Intronic
1180486541 22:15805786-15805808 GCAGCCTGTGCTCTGCAGACAGG - Intergenic
1180918390 22:19505495-19505517 GCTGCCTGTGCCCCTCAGGCTGG - Intronic
1181084071 22:20431254-20431276 CCTGCCTGTGCCACGCAGGCTGG - Exonic
1182298503 22:29325031-29325053 GCAACCTCTGCCTCCCAGGCTGG - Intergenic
1183414613 22:37675281-37675303 GGGGCCTGTGGCCAGCAGGCTGG - Intergenic
1183622387 22:38982102-38982124 GCAGCCTGAGCCTGGGAGGCGGG - Intronic
1184148253 22:42623976-42623998 CAAGCGTGTGGCCCGCAGGCGGG - Intronic
1184661165 22:45966200-45966222 TCATCCTGTGTCCCCCAGGCGGG + Intronic
1184689177 22:46109753-46109775 GCAGGCTGGGCCCTGCAGACAGG - Intronic
1184795362 22:46728968-46728990 GCAGCCAGGGCCTCGGAGGCTGG + Intronic
1185173018 22:49304440-49304462 GCTGCCTGTGGCCGGGAGGCAGG - Intergenic
950939975 3:16883594-16883616 TTAGGCTGGGCCCCGCAGGCCGG + Intronic
954384705 3:50237967-50237989 CAAGGCTGTGCCCCGGAGGCCGG - Intronic
954513104 3:51145499-51145521 GCAGCCTGTGGACCACAGGTTGG - Intronic
955217514 3:56996793-56996815 GCAACCTGTGGCCCGCAGGCGGG + Intronic
955237483 3:57152254-57152276 GCAGCCTCTGCCCAGCGGGCCGG - Intronic
955510582 3:59676666-59676688 GCAGCCTGTGGGCTGCAGGTTGG + Intergenic
955635653 3:61026556-61026578 GCAGCCTGTGGGCTGCAGGTTGG - Intronic
956370823 3:68558514-68558536 TCAGCCAGTGGCCAGCAGGCTGG - Intergenic
956678094 3:71753918-71753940 GCGGGCTGAGCCCCGCAGGACGG + Intronic
957983872 3:87547404-87547426 GAAACCTGTGCCCTGCTGGCTGG + Intergenic
961387373 3:126530154-126530176 GGAGCCTGGGCCCTGCAGACGGG - Intronic
967200920 3:187071728-187071750 ACAGCCTGTGTCGCCCAGGCTGG - Intronic
968427530 4:533591-533613 GCAGCCTGGGCACTGCAGGCAGG + Intronic
968479469 4:826878-826900 GCAGCCAGAGACCCGCAGGCCGG + Intergenic
968504683 4:966395-966417 ACAGCCTCTGCCCCACAGGGTGG - Intronic
968878505 4:3286678-3286700 GCAGCCTGTGGCAGCCAGGCGGG + Intergenic
969219996 4:5753148-5753170 GCAGCCTGTGCCCGGCATCATGG - Intronic
969323417 4:6426707-6426729 GCAGCCTGGGAAACGCAGGCTGG + Intronic
969494020 4:7515591-7515613 GCAGCATCTGCCCCACAGCCTGG - Intronic
969521075 4:7678056-7678078 CCAGCCTGTGTCCCGAGGGCAGG - Intronic
969611818 4:8231851-8231873 TGAGCCTGGGCCCCACAGGCGGG - Intronic
970018598 4:11540827-11540849 GCAGCCTGTGGGCTGCAGGTTGG + Intergenic
970271069 4:14348253-14348275 GCTGCTTCTGCCCTGCAGGCAGG + Intergenic
971405634 4:26319497-26319519 GCAGCGCGTGCCCGGGAGGCGGG - Intronic
975405319 4:73981936-73981958 GCAGCATGAGCTCCGCAGCCGGG - Exonic
978061566 4:104345613-104345635 CCAGCCTGTGGCTCCCAGGCTGG - Intergenic
981616236 4:146647738-146647760 GCCGCCTGAGCTCCGCAGGCAGG - Intergenic
982255555 4:153448029-153448051 GCAGGCTGTGCCCGGATGGCAGG + Intergenic
985104349 4:186486336-186486358 GCAGCCTGTGTCTTGCAGGAAGG - Intronic
985280240 4:188279237-188279259 GCAGCTTGGGCCCCTCAGGAAGG - Intergenic
985531314 5:435317-435339 CCAGCCTGTGCTGTGCAGGCAGG + Exonic
985645241 5:1081855-1081877 ACAGCTTGTGCGCCGCAAGCAGG + Intronic
985837715 5:2282642-2282664 GCAGCCGGTGAACAGCAGGCAGG + Intergenic
985854972 5:2417467-2417489 GCTGGCTGTGCTCCTCAGGCAGG + Intergenic
986172792 5:5327344-5327366 GCACCCTGAGCCCCGGTGGCTGG - Intergenic
987970859 5:24941817-24941839 GCATCCTGTGGGCCGCAGGTTGG + Intergenic
988238372 5:28575671-28575693 GCAGCCTCTGCTGCCCAGGCTGG + Intergenic
990165398 5:52989006-52989028 GCAGCCTGTCGCCAGCACGCAGG - Intergenic
994511471 5:100709257-100709279 TCAGCCTGGGCTACGCAGGCTGG + Intergenic
995128436 5:108603906-108603928 GCAGCCTGTGGGCTGCAGGTTGG + Intergenic
997453041 5:133998878-133998900 TCAGCCTGTGCCTAACAGGCAGG + Intronic
997613590 5:135231592-135231614 GCACCATGGGCCCCTCAGGCTGG + Intronic
999265494 5:150264499-150264521 GCAGCCTGTGCCCGGCCTGTGGG + Intronic
999798957 5:155015173-155015195 GCAGCATGTGGCCTGCAAGCTGG + Exonic
1000014975 5:157267896-157267918 GCAGCTTTGGCCCTGCAGGCAGG + Intronic
1002924761 6:1599033-1599055 GCAGCCTCTGCTCCCCAGGCCGG + Intergenic
1003508154 6:6756991-6757013 GCAACCTCTGCCTCCCAGGCTGG + Intergenic
1004134974 6:12957552-12957574 GCAGTCTGTGCCCCACCGGCTGG + Intronic
1004429675 6:15532189-15532211 ACTGCCTGTGCAGCGCAGGCTGG + Intronic
1004872616 6:19922551-19922573 GCAACATGGACCCCGCAGGCAGG + Intergenic
1006371752 6:33648977-33648999 GCAACCTCTGCCTCCCAGGCAGG + Intronic
1010388215 6:75306830-75306852 GCAACCTCTGCCTCCCAGGCTGG + Intronic
1013100487 6:106982407-106982429 GCAACCTCTGCCTCCCAGGCTGG + Intergenic
1013100495 6:106982457-106982479 GCAACCTCTGCCTCCCAGGCTGG + Intergenic
1013100503 6:106982507-106982529 GCAACCTCTGCCTCCCAGGCTGG + Intergenic
1013100511 6:106982557-106982579 GCAACCTCTGCCTCCCAGGCTGG + Intergenic
1013556206 6:111259574-111259596 GGAGCCGCTGCCCCGCAGCCGGG - Exonic
1015845240 6:137513437-137513459 GTGGCCTGAGCCCAGCAGGCCGG + Intergenic
1016674038 6:146742783-146742805 GCAGCCTATGGGCCGCAGGTTGG - Intronic
1016986651 6:149900473-149900495 ACAGCCGGTGCCTCCCAGGCAGG + Intergenic
1017740018 6:157398234-157398256 GAAGCTTTTGCCCAGCAGGCTGG + Intronic
1017892431 6:158649964-158649986 TCAGCCTGTGCCCGACAGGAAGG + Intergenic
1018230401 6:161669895-161669917 AGAGCCTGTGCGCTGCAGGCTGG - Intronic
1018422158 6:163648968-163648990 GAATCCTGAGCCCCGCATGCTGG + Intergenic
1018876543 6:167826916-167826938 GCCGCCTCAGCCCCGCCGGCCGG - Intronic
1019226038 6:170510274-170510296 GCAGCCTGTGGCACGGTGGCTGG + Intergenic
1019292252 7:256511-256533 GCAGCCTCAGCGCCGCAGCCCGG + Intronic
1019292466 7:257428-257450 GCCGCCTATCCCCCGCTGGCTGG - Intronic
1019313982 7:376220-376242 GCTGCCGGTGCCCCGGAGACAGG + Intergenic
1019562747 7:1666390-1666412 GCATCCAGAGCCCCGCGGGCGGG - Intergenic
1019666286 7:2253731-2253753 CCTGTGTGTGCCCCGCAGGCAGG - Exonic
1019667744 7:2260448-2260470 GCAGCCTGTGGGCCACAGGTTGG + Intronic
1019868595 7:3737153-3737175 GCAGGCTGTGCCCTGCAGTCGGG + Intronic
1019917024 7:4140178-4140200 GCAGCCTGTGAGGTGCAGGCTGG - Intronic
1020140185 7:5607568-5607590 GCAGCCAGGGCACTGCAGGCCGG + Intergenic
1020193399 7:6017873-6017895 GCAGCCTGTGCAGCACAAGCAGG - Exonic
1020260197 7:6526685-6526707 GCAAGCTGTGCCGCGCACGCCGG - Exonic
1020538788 7:9435157-9435179 GCCACCTGTGGCCTGCAGGCGGG - Intergenic
1021897513 7:25250920-25250942 GAAGCCTGTGACTCTCAGGCTGG + Intergenic
1023879688 7:44311549-44311571 CCAGCATGTGCCCCTGAGGCTGG + Intronic
1023999985 7:45183694-45183716 GCATCCTGTGCTCCGCAGGCTGG + Exonic
1026010553 7:66632455-66632477 CCAGCCTGTGTCACCCAGGCTGG - Intronic
1026588054 7:71673642-71673664 CCAGCCTGTGCCCCCCAGGCTGG + Intronic
1027183290 7:75954242-75954264 TCAGCCTGAGGCCCGCATGCAGG - Intronic
1027241324 7:76331448-76331470 GCAGCCTGTGGGCCACAGGTTGG - Intronic
1028357627 7:89928420-89928442 GCAGCCTGTGGGCCACAGGTTGG + Intergenic
1028922381 7:96322188-96322210 GCGGCCTCTGCCCTGCAGCCGGG + Intergenic
1033149184 7:138898362-138898384 GCAGCCAGGGCCAGGCAGGCAGG + Intronic
1033683714 7:143620682-143620704 CCAGCCTGTGCCCCGCCTCCGGG + Intergenic
1033700898 7:143836956-143836978 CCAGCCTGTGCCCCGCCTCCGGG - Intergenic
1034262031 7:149763260-149763282 GCAGTGTGTGCCCAGCAGGAAGG - Intergenic
1034411384 7:150944106-150944128 GCAGGCTGTGCCCAGCTGGGTGG - Intergenic
1034737639 7:153443897-153443919 GCAGACTGTGCCCTGCTGGCTGG + Intergenic
1035391806 7:158509172-158509194 GCAGCCTCCACCCAGCAGGCGGG + Intronic
1036389300 8:8310697-8310719 GCCGACTGTGCCCTGCAGCCGGG - Intergenic
1036664873 8:10731452-10731474 GCAGCCTGGGGACTGCAGGCTGG + Intronic
1037917032 8:22778977-22778999 GCAGCCCGTGCCCCCCACGCAGG - Intronic
1039554823 8:38468183-38468205 GGAGCTGGTGCCCCGGAGGCGGG + Intronic
1040711821 8:50198107-50198129 GCAGCCTGTGCCCAGAGCGCAGG + Intronic
1040964102 8:53066789-53066811 TCAGCCTGTGTCACCCAGGCTGG + Intergenic
1042484870 8:69338065-69338087 GCAGCCTCAGCTCTGCAGGCTGG - Intergenic
1044698850 8:94949026-94949048 GCAACCGGCGCCCCGAAGGCAGG + Intronic
1045028874 8:98116801-98116823 GCAGGCTGTGCTCCGCAGCGAGG + Intronic
1045385338 8:101666903-101666925 GAAGCCTGAGCCCCTCAGGAAGG + Exonic
1048255382 8:132901418-132901440 CCATCCTCTGCCCTGCAGGCTGG - Exonic
1048993488 8:139774993-139775015 GCAGCCTGTGCCCCACTATCTGG - Intronic
1049546716 8:143235385-143235407 GCACCATGTGCCTCGTAGGCAGG - Intergenic
1049670919 8:143869513-143869535 GCAGCCTGTGCCCCACAGGCAGG + Exonic
1049738404 8:144222208-144222230 GCTGCCAGTGCCCAGGAGGCTGG + Intronic
1050118685 9:2286668-2286690 ACAGCCTGTGCTCCACAGGATGG - Intergenic
1053269985 9:36743200-36743222 GCTGCCTGTGCTCAGCAGCCTGG + Intergenic
1053424973 9:38004588-38004610 CCACCCTCTGCCCCTCAGGCTGG - Intronic
1053455961 9:38233296-38233318 CCAGCCTGCGCCCTGGAGGCTGG + Intergenic
1056788054 9:89606384-89606406 GCAGCCTGCGCTCGGCAGGAAGG + Exonic
1057146326 9:92761608-92761630 CCTGCCTGTGCCCTGAAGGCAGG + Intronic
1057259616 9:93576519-93576541 GCGCCCTGAGCCCCGCGGGCCGG + Exonic
1059269254 9:113061696-113061718 GCAGCCTGAGCAGCGCAAGCCGG + Intergenic
1059270392 9:113067145-113067167 GCAGCCTGAGCAGCGCAAGCGGG + Intergenic
1059271528 9:113072595-113072617 GCAGCCTGAGCAGCGCAAGCGGG + Intergenic
1059272659 9:113078039-113078061 GCAGCCTGAGCAGCGCAAGCGGG + Intergenic
1059273794 9:113083481-113083503 GCAGCCTGAGCAGCGCAAGCGGG + Intergenic
1059274929 9:113088927-113088949 GCAGCCTGAGCAGCGCAAGCGGG + Intergenic
1060413305 9:123413895-123413917 GCAGCCTGTGCACCGGTGGAGGG - Intronic
1060493281 9:124100369-124100391 CCAGGCTGTGCCCAGCAGCCTGG - Intergenic
1060964663 9:127705906-127705928 GGTGCCTGTTCCCTGCAGGCAGG - Intronic
1061553173 9:131349717-131349739 GCAGCCTGGCACCCCCAGGCTGG - Intergenic
1061708724 9:132472735-132472757 GCAGCCTTTGTCACCCAGGCTGG - Intronic
1061800828 9:133112676-133112698 TCAGCCAGGGCCCCCCAGGCTGG - Intronic
1061954450 9:133954308-133954330 GCAGCCTGGGCCATGCATGCAGG - Intronic
1062394748 9:136348270-136348292 TCATGCTGTGCCCCGGAGGCAGG - Intronic
1062524114 9:136971440-136971462 GCAGCCTGTCCCCAGCAGTAGGG + Intronic
1186130764 X:6462986-6463008 GCAGTATGTGCGCAGCAGGCAGG + Intergenic
1187547116 X:20266074-20266096 GCCGCCCGTGCCCCGCGCGCCGG + Intronic
1187863661 X:23704516-23704538 GATGCCTGTGGCCCCCAGGCGGG - Intronic
1187900610 X:24024813-24024835 GAAGCCCGGGCTCCGCAGGCCGG + Intronic
1187913393 X:24131399-24131421 GCAGCCTCAACCTCGCAGGCTGG + Intergenic
1189151058 X:38707213-38707235 GCAGCCTGTGAGCTGCAGGTTGG + Intergenic
1190739823 X:53281470-53281492 GGAACCTGGGCCCCGCAGCCTGG - Intronic
1195748106 X:108138486-108138508 CCACCCTGGGCCCCACAGGCAGG - Intronic
1200060753 X:153482705-153482727 GCTGGCTGAGCCCTGCAGGCGGG - Intronic
1200124442 X:153806675-153806697 GCAGCCTCTGAGCCACAGGCAGG + Intronic
1201698408 Y:16853326-16853348 ACAGCCTGTGTCACCCAGGCTGG - Intergenic