ID: 1160694385

View in Genome Browser
Species Human (GRCh38)
Location 19:475503-475525
Sequence TCAGTTTTACCTTCTCCGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160694385_1160694398 29 Left 1160694385 19:475503-475525 CCCCACGGAGAAGGTAAAACTGA No data
Right 1160694398 19:475555-475577 GTGCAGAGGCCCTGGGGCAGCGG No data
1160694385_1160694394 21 Left 1160694385 19:475503-475525 CCCCACGGAGAAGGTAAAACTGA No data
Right 1160694394 19:475547-475569 AGGCAGCCGTGCAGAGGCCCTGG No data
1160694385_1160694389 -2 Left 1160694385 19:475503-475525 CCCCACGGAGAAGGTAAAACTGA No data
Right 1160694389 19:475524-475546 GAACAGTCCCAAAGCAGGTGAGG No data
1160694385_1160694396 23 Left 1160694385 19:475503-475525 CCCCACGGAGAAGGTAAAACTGA No data
Right 1160694396 19:475549-475571 GCAGCCGTGCAGAGGCCCTGGGG No data
1160694385_1160694393 15 Left 1160694385 19:475503-475525 CCCCACGGAGAAGGTAAAACTGA No data
Right 1160694393 19:475541-475563 GTGAGGAGGCAGCCGTGCAGAGG No data
1160694385_1160694388 -7 Left 1160694385 19:475503-475525 CCCCACGGAGAAGGTAAAACTGA No data
Right 1160694388 19:475519-475541 AAACTGAACAGTCCCAAAGCAGG No data
1160694385_1160694395 22 Left 1160694385 19:475503-475525 CCCCACGGAGAAGGTAAAACTGA No data
Right 1160694395 19:475548-475570 GGCAGCCGTGCAGAGGCCCTGGG No data
1160694385_1160694390 1 Left 1160694385 19:475503-475525 CCCCACGGAGAAGGTAAAACTGA No data
Right 1160694390 19:475527-475549 CAGTCCCAAAGCAGGTGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160694385 Original CRISPR TCAGTTTTACCTTCTCCGTG GGG (reversed) Intergenic