ID: 1160694391

View in Genome Browser
Species Human (GRCh38)
Location 19:475531-475553
Sequence GCTGCCTCCTCACCTGCTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1160694391_1160694403 14 Left 1160694391 19:475531-475553 CCCAAAGCAGGTGAGGAGGCAGC No data
Right 1160694403 19:475568-475590 GGGGCAGCGGCGAGGACAGCGGG No data
1160694391_1160694405 18 Left 1160694391 19:475531-475553 CCCAAAGCAGGTGAGGAGGCAGC No data
Right 1160694405 19:475572-475594 CAGCGGCGAGGACAGCGGGGAGG No data
1160694391_1160694399 6 Left 1160694391 19:475531-475553 CCCAAAGCAGGTGAGGAGGCAGC No data
Right 1160694399 19:475560-475582 GAGGCCCTGGGGCAGCGGCGAGG No data
1160694391_1160694402 13 Left 1160694391 19:475531-475553 CCCAAAGCAGGTGAGGAGGCAGC No data
Right 1160694402 19:475567-475589 TGGGGCAGCGGCGAGGACAGCGG No data
1160694391_1160694404 15 Left 1160694391 19:475531-475553 CCCAAAGCAGGTGAGGAGGCAGC No data
Right 1160694404 19:475569-475591 GGGCAGCGGCGAGGACAGCGGGG No data
1160694391_1160694396 -5 Left 1160694391 19:475531-475553 CCCAAAGCAGGTGAGGAGGCAGC No data
Right 1160694396 19:475549-475571 GCAGCCGTGCAGAGGCCCTGGGG No data
1160694391_1160694395 -6 Left 1160694391 19:475531-475553 CCCAAAGCAGGTGAGGAGGCAGC No data
Right 1160694395 19:475548-475570 GGCAGCCGTGCAGAGGCCCTGGG No data
1160694391_1160694398 1 Left 1160694391 19:475531-475553 CCCAAAGCAGGTGAGGAGGCAGC No data
Right 1160694398 19:475555-475577 GTGCAGAGGCCCTGGGGCAGCGG No data
1160694391_1160694394 -7 Left 1160694391 19:475531-475553 CCCAAAGCAGGTGAGGAGGCAGC No data
Right 1160694394 19:475547-475569 AGGCAGCCGTGCAGAGGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1160694391 Original CRISPR GCTGCCTCCTCACCTGCTTT GGG (reversed) Intergenic